Product Description
Storage/Stability
Workflow
Preparation Instructions
Procedure
Analysis
Troubleshooting Guide
Frequently Asked Questions
Protein-DNA interactions play critical roles in cellular functions including signal transduction, gene transcription, chromosome segregation, DNA replication/recombination, and epigenetic regulation. The Chromatin Immunoprecipitation (ChIP)20 technology provides a rapid and reliable method to investigate these protein‑DNA interactions in vivo.
Our Imprint Chromatin Immunoprecipitation Kit uses a plate-based system to allow rapid ChIP assays in a high-throughput format. The plate method limits the sensitivity of the process, and as such this kit is best used to characterize abundant protein-DNA events, e.g., histone or RNA polymerase II events. The protocol is optimized for chromatin isolated from 100,000-250,000 cells/ChIP reaction/well. Using more cells per well may increase non-specific background binding and reduce target enrichment.
The Imprint ChIP procedure is ideal for kinetic or drug screening studies of abundant, known protein-DNA interactions.13, 14 It utilizes an abbreviated method starting with cross-linking of mammalian cells or tissue followed by chromatin extraction. The chromatin is then sheared and captured in antibody-coated microwells, the cross-links are reversed, and the DNA is purified by spin column cleanup.
The CHP1 kit provides reagents for a one-day immunoprecipitation and purification of DNA from mammalian cells or tissue, faster than any other commercially available kit. The kit includes mouse IgG, anti-RNA Polymerase II, and human GAPDH primers for use as negative and positive controls. The resultant DNA is suitable for downstream applications ranging from individual target characterization to genome-wide profiling techniques. Additionally, an optimized GenomePlex Whole Genome Amplification (WGA) method is available for amplification of ChIP DNA.15, 16, 18
Kit Components |
---|
Optimize shearing conditions for your sample:
The equipment and sample type used in preparing the sheared chromatin can have a significant impact on the success of the experiment. The CHP1 kit was conceived for known protein-DNA events, and so a limited amount of extra reagents have been included for optimization. Additional Nuclei Preparation Buffer, Homogenization Buffer, and Shearing Buffer are provided for approximately 4 additional sample optimizations. See Troubleshooting Guide for more information.
Sonication has to be optimized for each cell line and the instrument. We recommend the Diagenode Biodisruptor (water based sonication) for reproducible sonication. A good starting point is 5, 10, and 15 minutes at High “H” setting with
30 seconds “ON” and 30 seconds “OFF” cycle.
Run a gel to check sonication:
i) Use 10 µL sample and add 40 µL H2O
ii) Reverse cross-link by adding 2 µL of 5 M NaCl (Final concentration 0.2 M NaCl)
iii) Boil for 15 minutes
iv) After returning to room temperature, add 1 µL of 10 mg/mL RNase A at 37 °C for 10 mins
v) Clean and purify DNA with GenElute PCR Clean-Up Kit (NA1020)
vi) Load 1 and 4 µL of sonicated DNA on gel and determine size of smear
vii) The sonication condition that gives a smear of DNA sizes from 200 bp to 1 kb with a peak around 500 bp (2-3 nucleosomes) should be used for ChIP reactions.
Thoroughly mix reagents. Examine the reagents for precipitation. If any reagent has formed a precipitate, warm at 55 °C until dissolved. Allow to equilibrate to room temperature before use.
Wash Solution: Dilute the Wash Solution Concentrate with 12 mL (24 Rxn) or 44 mL (96 Rxn) of ethanol, 200 proof, for molecular biology. After each use, tightly cap the diluted Wash Solution to prevent the evaporation of ethanol.
1.25 M Glycine: Prepare a 1.25 M glycine stock solution. Store at 2-8 °C when not in use. Remake fresh stock after 6 months.
65 °C incubator: Preheat a waterbath, incubator, or hybridization oven to 65 °C.
I. Bind antibody to the assay wells
II.A. Cell culture sample preparation
II.B. Tissue Sample Preparation
III. Protein/DNA Immunoprecipitation
IV. Cross-Link Reversal
V. DNA Purification
Quantification of ChIP DNA
The amount of template pulled down from a ChIP reaction is dependent on many factors: number and type of cells, treatment, template length due to sonication, etc. Often the concentration of the sample cannot be accurately quantified via a simple spectrophotometric (A260) reading. The following two methods are suggested as possibilities to this minor technical dilemma.
PCR Conditions (provided primer set)
If conventional PCR or qPCR is performed, control human GAPDH primers included in the kit can be used as a positive control for human source material
(246 bp amplicon). If using SYBR® Green JumpStart Taq ReadyMix™ (S4438), use these cycling parameters:
hGAPDH For caattccccatctcagtcgt
hGAPDH Rev tagtagccgggccctacttt
Other sources of ChIP material will require control primers designed by the user. The number of cycles for conventional PCR will also need to be optimized by the user.
Amplification (Optional)
After ChIP, only a few nanograms of template are available for downstream use. Amplification of this template expands the number, and scope of genome-wide analyses.
GenomePlex Whole Genome Amplification (WGA) has proven to be an effective method to amplify ChIP DNA.15, 16, 18 The kit utilizes a proprietary amplification technology based upon initial nicking of genomic DNA to relax the template for the subsequent hybridization of a unique dual-function primer. One function of the primer is to representatively anneal roughly every 500 bp throughout the entire genome. After annealing, the adjacent template is extended to create PCR amplifiable OmniPlex® fragments flanked by universal priming sites, creating a library, which represents the entire genome. The OmniPlex library is then PCR amplified using universal oligonucleotide primers complementary to the initial primer sequence; hence, the second function of the WGA primer.
The GenomePlex Complete Whole Genome Amplification (WGA) Kit is recommended18 for amplification of immunoprecipitated DNA with the following modifications.
Troubleshooting Guide |
---|
Can the number of cells be increased? What is the maximum and minimum number of cells that can be used with this kit?
The range of cells that can be used with this kit is 0.2–2.5 x 105/well/ChIP sample. Using more than 0.5 million cells per well will increase the non-specific binding and reduce the yield and specificity of the ChIP reaction. If higher yield of ChIP DNA is desired for downstream applications (e.g. ChIP-Seq., ChIP-chip): a) DNA could be pooled by eluting consecutively (with 50 µL of elution buffer) from multiple individual ChIP reactions; or b) DNA may be amplified using one of our Whole Genome Amplification kits (WGA2 or WGA4).
Is the kit compatible with lysing enzymes if sonication does not work? Yes, sheared chromatin can also be made by enzymatic (Micrococcal nuclease, MNase) digestion (reagents/protocol not provided in kit). The amount, temperature and duration of the MNase treatment will have to be optimized by the user depending on the cell line.
Can this kit be used with plants? Reptilian cells?
Yes, the kit is compatible with sonicated chromatin prepared from plants or reptilian cells, provided the user has optimized conditions for cross-linking and preparation of appropriately sized sonicated chromatin.
How is the qPCR data analyzed post ChIP analysis?
How is “% Input” and “Fold Enrichment” calculated?
ChIP-qPCR Data Analysis (ΔΔCt method)17,19
i. Normalize each ChIP DNA fractions’ Ct value to the Input DNA fraction Ct value for the same qPCR Assay (ΔCt) to account for chromatin sample preparation differences.
ΔCt [normalized ChIP] = (Ct [ChIP] - (Ct [Input] - Log2 (Input Dilution Factor)))
Where, Input Dilution Factor = (fraction of the input chromatin saved)-1 The default Input fraction is 1% which is a dilution factor of 100 or 6.644 cycles (i.e. log2 of 100). Thus, subtract 6.644 from the Ct value of the 1% Input sample as mentioned in the equation above.
Average normalized ChIP Ct values for replicate samples.
ii. Calculate the % Input for each ChIP fraction (linear conversion of the normalized ChIP ΔCt).
% Input = 2 (-ΔCt [normalized ChIP])
iii. Adjust the normalized ChIP fraction Ct value for the normalized background [non-specific (NS) Ab] fraction Ct value (first ΔΔCt).
ΔΔCt [ChIP/NS] = ΔCt [normalized ChIP] - ΔCt [normalized NS]
iv. Calculate Assay Site IP Fold Enrichment above the sample specific background (linear conversion of the first ΔΔCt).
Fold Enrichment = 2 (-ΔΔCt [ChIP/NIS])
Bioruptor is a trademark of Diagenode SA.
GenomePlex and OmniPlex are registered trademarks of Rubicon Genomics, Inc.
Quant-iT is a trademark of Invitrogen.
SYBR is a registered trademark of Molecular Probes, Inc.
Parafilm is a registered trademark of American Can Co.