Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU210421

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Erbb2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTGTCCCCCGAACAACCAAGAGGTCACAGCTGAGGACGGAACACAGCGGTGTGAGAAATGCAGCAAGCCCTGTGCTGGAGTATGCTATGGTCTGGGCATGGAGCACCTCCGAGGGGCGAGGGCCATCACCAGTGACAATATCCAGGAGTTTGCTGGCTGCAAGAAGATCTTTGGGAGCCTGGCATTTTTGCCGGAGAGCTTTGATGGGAACCCCTCCTCCGGCGTTGCCCCACTGAAGCCAGAGCATCTCCAAGTGTTCGAAACCCTGGAGGAGATCACAGGTTACCTATACATTTCAGCATGGCCAGAGAGCTTCCAAGACCTCAGTGTCTTCCAGAACCTTCGGGTCATTCGGGGACGGATTCTCCATGATGGTGCTTACTCATTGACGTTGCAAGGCCTGGGGATTCACTCACTGGGGCTACGCTCACTGCGGGAGCTGGGCAGTGGATTGGCTCTCATTCACCGCAACACCCATCTCTGCTTTGTAAACACTGTACCTTGGGACCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chiao-Yun Lin et al.
Journal of molecular medicine (Berlin, Germany), 92(9), 969-981 (2014-05-14)
Endometrial cancers have been recently molecularly characterized; amplifications of human epidermal growth factor receptor 2 (HER2) were seen in 25 % of the serous-like tumors, and mutations in the PI(3)K/AKT pathways were seen in 93 % of endometrioid tumors. These new findings
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Yu-Chieh Tsai et al.
Molecular cancer therapeutics, 14(3), 810-820 (2015-01-16)
Blockade of EGFR has been proved useful in enhancing the effect of radiotherapy, but the advantages of new-generation EGFR tyrosine kinase inhibitors (TKI) in radiosensitization are not well known. We used two human bladder cancer cells with wild-type EGFR to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service