Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU038061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atg5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCGAGATGTGTGGTTTGGACGAATTCCAACTTGCTTTACTCTCTATCAGGATGAGATAACTGAAAGAGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTCAGCTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGATGTTAGTGAGATATGGTTTGAATATGAAGGCACACCCCTGAAATGGCATTATCCAATTGGTTTACTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTCAAGAGTTTTCCAGAAAAGGACCTTCTACACTGTCCATCCAAGGATGCGGTTGAGGCTCACTTTATGTCGTGTATGAAAGAAGCTGATGCTTTAAAGCATAAAAGTCAAGTGATCAACGAAATGCAGAAAAAAGACCACAAGCAGCTCTGGATGGGACTGCAGAATGACAGATTTGACCAGTTTTGGGCCATCAACCGGAAACTCATGGAAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiqiang Liu et al.
Oncotarget, 6(33), 34329-34341 (2015-10-13)
A major problem in patients with multiple myeloma is chemotherapy resistance, which develops in myeloma cells upon interaction with bone marrow stromal cells. However, few studies have determined the role of bone marrow adipocytes, a major component of stromal cells
Rongsong Li et al.
Antioxidants & redox signaling, 23(15), 1207-1219 (2015-06-30)
Temporal and spatial variations in shear stress are intimately linked with vascular metabolic effects. Autophagy is tightly regulated in intracellular bulk degradation/recycling system for maintaining cellular homeostasis. We postulated that disturbed flow modulates autophagy with an implication in mitochondrial superoxide
Mark Thomas et al.
Frontiers in cell and developmental biology, 8, 565915-565915 (2020-11-13)
Many clinical trials are beginning to assess the effectiveness of compounds known to regulate autophagy in patients receiving anti-cancer chemotherapy. However, autophagy inhibition, through exogenous inhibitors, or activation, through starvation, has revealed conflicting roles in cancer management and chemotherapeutic outcome.
Qun Wu et al.
PloS one, 10(4), e0124524-e0124524 (2015-04-17)
Human rhinovirus (HRV) is the most common cause of acute exacerbations of chronic lung diseases including asthma. Impaired anti-viral IFN-λ1 production and increased HRV replication in human asthmatic airway epithelial cells may be one of the underlying mechanisms leading to
Hongming Pan et al.
Scientific reports, 4, 6683-6683 (2014-10-21)
Autophagy is a critical survival pathway for cancer cells under conditions of stress. Thus, induction of autophagy has emerged as a drug resistance mechanism. This study is to determine whether autophagy is activated by a novel multikinase inhibitor linifanib, thereby

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service