Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU019041

Sigma-Aldrich

MISSION® esiRNA

targeting human STK11

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAAGAGAAGCAGAAAATATATCCTTTCCGCCCTTACTGCGTGTGTGGCATGCAGGAAATGCTGGACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTGATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGGAACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCACTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAGCCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCGGCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATCTACAAGTTGTTTGAGAACATCGGGAAGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qing Ma et al.
Oncology letters, 16(1), 1291-1297 (2018-07-03)
Liver kinase B1 (LKB1) encodes a serine/threonine kinase and functions as a tumor suppressor. LKB1 loss-of-function somatic mutations are frequently observed in sporadic types of cancer, particularly in lung cancer. Ectopic LKB1 induces growth arrest by upregulating p21/cyclin dependent kinase
Taiyuan Li et al.
Biochemical and biophysical research communications, 482(4), 1037-1041 (2016-12-03)
Partitioning defective 3-like protein (Par3L) is a recently identified cell polarity protein that plays an important role in mammary stem cell maintenance. Previously, we showed that high expression of Par3L is associated with poor survival in malignant colorectal cancer (CRC)
Youn Ju Lee et al.
PloS one, 14(1), e0211415-e0211415 (2019-01-30)
Alcoholic liver disease (ALD) is a worldwide health problem and hepatocyte apoptosis has been associated with the development/progression of ALD. However, no definite effective pharmacotherapy for ALD is currently available. Cilostazol, a selective type III phosphodiesterase inhibitor has been shown
Shalini V Rao et al.
BMC cancer, 17(1), 68-68 (2017-01-23)
The peptide hormone gastrin exerts a growth-promoting effect in both normal and malignant gastrointestinal tissue. Gastrin mediates its effect via the cholecystokinin 2 receptor (CCKBR/CCK2R). Although a substantial part of the gastric adenocarcinomas express gastrin and CCKBR, the role of
Jacob M Kaufman et al.
Cancer research, 77(1), 153-163 (2016-11-09)
LKB1 is a commonly mutated tumor suppressor in non-small cell lung cancer that exerts complex effects on signal transduction and transcriptional regulation. To better understand the downstream impact of loss of functional LKB1, we developed a transcriptional fingerprint assay representing

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service