Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU009621

Sigma-Aldrich

MISSION® esiRNA

targeting human ERRFI1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCAGCTGGCTCCTTTAACAAGCCAGCCATAAGGATATCCAACTGTTGTATACACAGAGCTTCTCCTAACTCCGATGAAGACAAACCTGAGGTTCCCCCCAGAGTTCCCATACCTCCTAGACCAGTAAAGCCAGATTATAGAAGATGGTCAGCAGAAGTTACTTCGAGCACCTATAGTGATGAAGACAGGCCTCCCAAAGTACCGCCAAGAGAACCTTTGTCACCGAGTAACTCGCGCACACCGAGTCCCAAAAGCCTTCCGTCTTACCTCAATGGGGTCATGCCCCCGACACAGAGCTTTGCCCCTGATCCCAAGTATGTCAGCAGCAAAGCACTGCAAAGACAGAACAGCGAAGGATCTGCCAGTAAGGTTCCTTGCATTCTGCCCATTATTGAAAATGGGAAGAAGGTTAGTTCAACACATTATTACCTACTACCTGAACGACCACCATACCTGGACAAATATGAAAAATTTTTTAGGGAAGCAGAAGAAACAAATGGAGGCGCCCAAATCCAGCCATTACCTGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Da Hyun Kang et al.
BMC cancer, 20(1), 571-571 (2020-06-20)
The resistance of lung cancer to epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is one of the unconquered frontiers in chemotherapy. Mitogen-inducible gene 6 (Mig-6) is known to inhibit the kinase activity of epidermal growth factor receptor (EGFR). Similarly, numerous
Soyoung Park et al.
Oncotarget, 7(8), 8916-8930 (2016-01-14)
Hexavalent Chromium [Cr(VI)] compounds are human lung carcinogens and environmental/occupational hazards. The molecular mechanisms of Cr(VI) carcinogenesis appear to be complex and are poorly defined. In this study, we investigated the potential role of Gene 33 (ERRFI1, Mig6), a multifunctional
Zixuan Li et al.
Experimental and molecular pathology, 102(3), 492-499 (2017-05-17)
The ablation of Mig-6 has been shown to induce tumor formation in various tissues. However, the relationships between Mig-6 expression, clinical pathological factors, and prognosis have not been clarified in hepatocellular carcinoma (HCC), and the mechanism by which Mig-6 regulates
Malgorzata Milewska et al.
PloS one, 10(6), e0129859-e0129859 (2015-06-13)
BRAF functions in the RAS-extracellular signal-regulated kinase (ERK) signaling cascade. Activation of this pathway is necessary to mediate the transforming potential of oncogenic BRAF, however, it may also cause a negative feedback that inhibits the epidermal growth factor receptor (EGFR).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service