Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

More Documents

EHU002271

Sigma-Aldrich

MISSION® esiRNA

targeting human LEF1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACCCCACCTCTTGGCTGGCAAGGTCAGCCTGTATATCCCATCACGGGTGGATTCAGGCAACCCTACCCATCCTCACTGTCAGTCGACACTTCCATGTCCAGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGCATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGTGACCTAATGCACGTGAAGCCTCA

Ensembl | human accession no.

ENSG00000138795

NCBI accession no.

NM_016269

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LEF1(51176) , LEF1(51176)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rhys G Morgan et al.
Haematologica, 104(7), 1365-1377 (2019-01-12)
Canonical Wnt/β-catenin signaling is frequently dysregulated in myeloid leukemias and is implicated in leukemogenesis. Nuclear-localized β-catenin is indicative of active Wnt signaling and is frequently observed in acute myeloid leukemia (AML) patients; however, some patients exhibit little or no nuclear
Yaoyao Chen et al.
Stem cell reports, 1(3), 209-217 (2013-12-10)
Germline-competent embryonic stem cells (ESCs) have been derived from mice and rats using culture conditions that include an inhibitor of glycogen synthase kinase 3 (GSK3). However, rat ESCs remain susceptible to sporadic differentiation. Here, we show that unsolicited differentiation is
Julia Dräger et al.
Oncotarget, 8(2), 3259-3273 (2016-12-15)
Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children and show characteristics of skeletal muscle differentiation. The two major RMS subtypes in children are alveolar (ARMS) and embryonal RMS (ERMS). We demonstrate that approximately 50% of ARMS and
P Wu et al.
Cell death & disease, 5, e1085-e1085 (2014-03-01)
Inhibitor-of-apoptosis protein (IAP) inhibitors have been reported to synergistically reduce cell viability in combination with a variety of chemotherapeutic drugs via targeted cellular IAP (cIAP) depletion. Here, we found that cIAP silencing sensitised colorectal cancer (CRC) cells to selenite-induced apoptosis.
Xinyu Wang et al.
Journal of Cancer, 11(10), 3072-3081 (2020-04-01)
Background: Our previous studies reported that lymphoid enhancer-binding factor 1 (LEF1) was upregulated in esophageal squamous cell carcinoma (ESCC) and the positive expression of LEF1 was correlated with aberrant clinicopathological characteristics in ESCC patients. However, the upstream mechanism of regulating
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service