Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU208521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Emr1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGTGTGATGACACATGTCCTTTGAATTCATCATGTACCAACACTATTGGGAGCTACTTCTGCACTTGCCACCCTGGCTTTGCATCTAGCAATGGACAGCTGAATTTCAAAGACCTAGAGGTGACATGTGAAGATATTGATGAGTGCACCCAAGATCCATTACAATGTGGACTGAATTCTGTCTGCACCAATGTACCAGGCTCCTACATCTGTGGCTGCCTCCCTGACTTTCAAATGGATCCAGAAGGCTCCCAAGGATATGGAAACTTCAACTGCAAAAGGATCCTCTTCAAGTGTAAGGAAGACTTGATACTCCAAAGTGAGCAGATACAGCAATGCCAAGCAGTGCAGGGCAGGGATCTTGGTTATGCTTCCTTCTGTACACTTGTGAATGCTACCTTCACAATCCTTGATAATACCTGTGAGAACAAAAGTGCCCCAGTGTCCTTACAGAGTGCAGCTACAAGTGTCTCCCTCGTGCTGGAGCAAGCGACCACATGGTTTGAGCTCAGCA

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000004730

numer dostępu NCBI

NM_010130

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... EMR1(13733) , Emr1(13733)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Michael J Hansen et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 64(9), 697-706 (2015-07-08)
Adipose tissue macrophages (ATMs) have been implicated in a number of obesity-related diseases. Because the activated macrophages associated with many types of autoimmune and inflammatory diseases express a folate receptor (FR) that can be exploited for FR-targeted drug delivery, we
Takako Serizawa et al.
Infection and immunity, 84(2), 562-572 (2015-12-09)
Histopathological changes of the gastric mucosa after Helicobacter pylori infection, such as atrophy, metaplasia, and dysplasia, are considered to be precursors of gastric cancer, yet the mechanisms of histological progression are unknown. The aim of this study was to analyze
Fabiana N Soki et al.
Oncotarget, 6(34), 35782-35796 (2015-10-16)
Resident macrophages in bone play important roles in bone remodeling, repair, and hematopoietic stem cell maintenance, yet their role in skeletal metastasis remains under investigated. The purpose of this study was to determine the role of macrophages in prostate cancer
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej