Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU202811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptprc

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TAAATACTATGAAGTGTCCCTACTTGCCTATGTCAATGGGAAGATTCAAAGAAATGGGACTGCTGAGAAGTGCAATTTTCACACAAAAGCAGATCGTCCGGACAAGGTCAATGGAATGAAAACCTCCCGGCCGACAGACAATAGTATAAATGTTACATGTGGTCCTCCTTATGAAACTAATGGCCCTAAAACCTTTTACATTTTGGTAGTCAGAAGTGGAGGTTCTTTTGTTACAAAATACAACAAGACAAACTGTCAGTTTTATGTAGATAATCTCTACTATTCAACTGACTATGAGTTTCTGGTCTCTTTTCACAATGGAGTGTACGAGGGAGATTCAGTTATAAGAAATGAGTCAACAAATTTTAATGCTAAAGCACTGATTATATTCCTGGTGTTTCTGATTATTGTGACATCAATAGCCTTGCTTGTTGTTTTGTATAAAATCTATGATCTGCGCAAGAAAAGATCCAGCAATTTAGATGAACAACAGGAACTCGTTGAAAGGGA

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000026395

numer dostępu NCBI

NM_011210

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... PTPRC(19264) , Ptprc(19264)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Iwona Grabowska et al.
Journal of muscle research and cell motility, 36(6), 395-404 (2015-11-29)
The skeletal muscle injury triggers the inflammatory response which is crucial for damaged muscle fiber degradation and satellite cell activation. Immunodeficient mice are often used as a model to study the myogenic potential of transplanted human stem cells. Therefore, it
Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.
Xu Chang Geng et al.
Molecular medicine reports, 11(5), 3860-3865 (2015-01-13)
Erythropoietin (EPO) is a hematopoietic hormone that protects against renal interstitial fibrosis in animal models; however, the mechanism underlying the anti‑fibrotic activity of EPO has remained elusive. The present study aimed to elucidate this mechanism. Twenty‑four male C57BL6 mice were
Kunitoshi Kobayashi et al.
International immunology, 27(7), 333-344 (2015-02-28)
Dimethyl fumarate (DMF) is a modifier of the nuclear factor (erythroid-derived 2)-2 (Nrf2)-kelch-like ECH-associated protein 1 (Keap1) pathway. DMF treatment in the effector phase significantly suppressed the development of Theiler's murine encephalomyelitis virus-induced demyelinating disease (TMEV-IDD) both clinically and histologically.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej