Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU182841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd68

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCTTGGGGCATATCTGTTTTGAATCCCAACAAAACCAAGGTCCAGGGAGGTTGTGACGGTACCCATCCCCACCTGTCTCTCTCATTTCCTTATGGACAGCTTACCTTTGGATTCAAACAGGACCTACATCAGAGCCCGAGTACAGTCTACCTGGACTACATGGCGGTGGAATACAATGTGTCCTTCCCACAGGCAGCACAGTGGACATTCATGGCGCAGAATTCATCTCTTCGAGAGCTCCAAGCTCCCTTGGGCCAAAGCTTCTGCTGTGGAAATGCAAGCATAGTTCTTTCTCCAGCTGTTCACCTTGACCTGCTCTCTCTAAGGCTACAGGCTGCTCAGCTGCCTGACAAGGGACACTTCGGGCCATGTTTCTCTTGCAACCGTGACCAGTCCCTCTTGCTGCCTCTCATCATTGGCCTGGTCCTCCTCGGCCTCCTCACCCTGGTGCTCATCGCCTTCTGCATCACCCGCAGACGACAATCAACCTACCAGCCCCTCTGAGCATC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000018774

numer dostępu NCBI

NM_009853

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... CD68(12514) , Cd68(12514)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Przepraszamy, ale COA dla tego produktu nie jest aktualnie dostępny online.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Bao-xiang Pei et al.
The Journal of thoracic and cardiovascular surgery, 148(4), 1208-1216 (2014-06-08)
Recent experimental evidence has indicated that interstitial tumor-associated macrophages (TAMs), tumor-derived macrophage colony-stimulating factor (also known as CSF-1), and interleukin-6 (IL-6) interact in the pathogenesis of malignant epithelial tumors, including lung cancer. The present study aimed to explore their relationship
Carlos Tarin et al.
Scientific reports, 5, 17135-17135 (2015-12-01)
CD163 is a membrane receptor expressed by macrophage lineage. Studies performed in atherosclerosis have shown that CD163 expression is increased at inflammatory sites, pointing at the presence of intraplaque hemorrhagic sites or asymptomatic plaques. Hence, imaging of CD163 expressing macrophages
Andrea Doni et al.
The Journal of experimental medicine, 212(6), 905-925 (2015-05-13)
Pentraxin 3 (PTX3) is a fluid-phase pattern recognition molecule and a key component of the humoral arm of innate immunity. In four different models of tissue damage in mice, PTX3 deficiency was associated with increased fibrin deposition and persistence, and

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej