Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU173171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chn1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTGAAGATGTCAAGATGGCTTTTGATAGAGATGGTGAGAAGGCGGATATTTCTGTGAACATGTATGAGGACATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATCTGCCAATTCCTCTCATCACATACGATGCCTACCCCAAGTTCATTGAGTCTGCCAAAATTATGGACCCTGACGAGCAATTGGAGACCCTTCACGAAGCACTGAGATCGCTGCCGCCTGCCCACTGCGAGACGCTCCGGTACCTCATGGCGCATCTCAAGAGAGTGACCCTTCATGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATCGTGTTTGGACCAACCCTCATGAGATCCCCAGAGCTCG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000056486

numer dostępu NCBI

NM_029716

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... CHN1(108699) , Chn1(108699)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Junlan Feng et al.
Journal of cellular and molecular medicine, 18(10), 2125-2134 (2014-09-19)
Our previously published study documented a deregulation of the microRNA miR-150 in colorectal cancer. Here, we investigated further, in vitro and in vivo, the potential molecular mechanisms underlying the involvement of miR-150 in colorectal cancer, using the appropriate molecular biological
Chao Zeng et al.
American journal of physiology. Endocrinology and metabolism, 307(4), E384-E397 (2014-07-10)
Activation of conventional PKCs (cPKC) is a key signaling that directs the cardiac toxicity of hyperglycemia. AKAP150, a scaffold protein of the A-kinase anchoring proteins (AKAPs) family, is less defined regarding its capability to anchor and regulate cardiac cPKC signaling.
Han Lin et al.
Molecular and cellular biology, 35(21), 3657-3668 (2015-08-19)
Cdc14 is a phosphatase that controls mitotic exit and cytokinesis in budding yeast. In mammals, the two Cdc14 homologues, Cdc14A and Cdc14B, have been proposed to regulate DNA damage repair, whereas the mitotic exit and cytokinesis rely on another phosphatase
Peng Yang et al.
Cellular signalling, 27(7), 1525-1532 (2015-03-18)
Surgery-induced inflammation has been associated with cancer recurrence and metastasis in colorectal cancer (CRC). As a constituent of gram-negative bacteria, lipopolysaccharide (LPS) is frequently abundant in the peri-operative window. However, the definite roles of LPS in tumour progression remain elusive.
Deguang Xing et al.
Oncology reports, 31(6), 2692-2700 (2014-04-24)
In the present study, we designed and conducted a series of assays to determine the expression of voltage-gated sodium channel (VGSC) neonatal isoform Nav1.5 (nNav1.5) in human brain astrocytoma and its effect on the proliferation, migration, invasion and apoptosis of
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej