Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU170821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Birc5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCAAAGGAGACCAACAACAAGCAAAAAGAGTTTGAAGAGACTGCAAAGACTACCCGTCAGTCAATTGAGCAGCTGGCTGCCTAATGCTGAGCCTTTGCTGAGATAACTTGGACCTGAGTGACATGCCACATCTAAGCCACGCATCCCAGCTTTTCCAGCCAGGGCCTCCTAGCAGGATCTTAGAGAAGGAGACAGTGGTATTTTGAAACTGGATATCAAATATTTTTGGTTTTGCTTTAAAGTGGCTACCTCTCTTTGGTTTTGTGGCTTTGCTCTATTGTGACGTGGACTTAAGCAATAAGGAAGTGATGAAGGGACAGTGTTCTCTGACAGGACCTGTGGGGGTCGGGGTGCCTGTGCAAGGTCTTGGTTCTGATTGTGATATTTCCATACAGGGCTGCTAATGCAGCCCATGGGTAAGTGTGGTTATATGTGTTTGTGCTGATAATTTTGTCCTGATGAGTTTTCCTACCACGGGGTAACGG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000017716

numer dostępu NCBI

NM_009689

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... BIRC5(11799) , Birc5(11799)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Eloïse Véquaud et al.
Breast cancer research and treatment, 155(1), 53-63 (2015-12-19)
Survivin overexpression, frequently found in breast cancers and others, is associated with poor prognosis. Its dual regulation of cell division and apoptosis makes it an attractive therapeutic target but its exact functions that are required for tumor maintenance are still
Sanam Arami et al.
Current pharmaceutical design, 23(16), 2400-2409 (2016-11-02)
Targeted delivery of small interfering RNA (siRNA) to the specific tumor tissues and cells is the key challenge in the development of RNA interference as a therapeutic application. To target breast cancer, we developed a cationic nanoparticle as a therapeutic
Yongping Cai et al.
International journal of clinical and experimental pathology, 8(10), 13267-13272 (2016-01-02)
Survivin, a member of the inhibitor of apoptosis gene family regulates two critical processes in neoplastic transformation, namely, cell proliferation and apoptosis. This study aimed to detect the effect of survivin on tumor growth of colorectal cancer (CRC) in vivo.
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
Yuhuan Li et al.
Pakistan journal of pharmaceutical sciences, 28(5 Suppl), 1887-1890 (2015-11-04)
Breast cancer resistance to therapy can result from expression of antiapoptotic genes. Survivin is an antiapoptotic gene that is over expressed in most human tumors. RNA interference using short interfering RNA (siRNA) can be used to specifically inhibit survivin expression.
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej