Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU084951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptpn6

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGAGAATCGGGTCTTGGAACTGAACAAGAAGCAGGAGTCGGAGGACACACGCAAGGCTGGCTTCTGGGAGGAGTTTGAGAGTCTACAAAAGCAGGAGGTAAAGAATCTACACCAACGTCTGGAAGGGCAGCGGCCAGAGAACAAGAGCAAGAACCGCTACAAGAACATTCTTCCCTTTGACCACAGCCGAGTGATCCTGCAGGGACGTGACAGTAACATCCCAGGCTCTGACTACATCAATGCCAACTACGTGAAGAACCAGCTGCTAGGTCCAGATGAGAACTCTAAGACCTACATCGCCAGCCAGGGCTGTCTGGATGCCACAGTCAATGACTTCTGGCAGATGGCTTGGCAGGAGAACACTCGTGTCATCGTCATGACTACCAGAGAGGTGGAGAAAGGCCGGAACAAATGTGTCCCATACTGGCCCGAGGTGGGCACTCAGCGTGTCTATGGTCTCTACTCTGTGACCAACAGTAGGGAGCATGACACAGCAG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000004266

numer dostępu NCBI

NM_013545

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... PTPN6(15170) , Ptpn6(15170)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jieqiong Wang et al.
Breast cancer research and treatment, 148(2), 279-289 (2014-10-11)
Signal transducer and activator of transcription 3 (STAT3) is implicated breast cancer metastasis and represents a potential target for developing new anti-tumor metastasis drugs. The purpose of this study is to investigate whether the natural agent 1'-acetoxychavicol acetate (ACA), derived
Tiantian Sun et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(17), 4689-4704 (2014-07-06)
The role and clinical implication of the transmembrane protein with EGF and two follistatin motifs 2 (TMEFF2) in gastric cancer is poorly understood. Gene expression profile analyses were performed and Gene Set Enrichment Analysis (GSEA) was used to explore its
Ji Hoon Jung et al.
British journal of pharmacology, 172(14), 3565-3578 (2015-04-01)
Epigallocatechin-3-gallate (EGCG) is a component of green tea known to have chemo-preventative effects on several cancers. However, EGCG has limited clinical application, which necessitates the development of a more effective EGCG prodrug as an anticancer agent. Derivatives of EGCG were
Ross C Gruber et al.
Glia, 63(10), 1753-1771 (2015-04-29)
We have previously described reduced myelination and corresponding myelin basic protein (MBP) expression in the central nervous system of Src homology 2 domain-containing protein tyrosine phosphatase 1 (SHP-1) deficient motheaten (me/me) mice compared with normal littermate controls. Deficiency in myelin
Chulwon Kim et al.
Molecular carcinogenesis, 53(10), 793-806 (2013-06-15)
Constitutive activation of STAT3 is frequently observed and closely linked with proliferation, survival, invasion, metastasis and angiogenesis in tumor cells. In the present study, we investigated whether β-caryophyllene oxide (CPO), a sesquiterpene isolated primarily from the essential oils of medicinal

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej