Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU063061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse C3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GACGCCACTATGTCCATCCTGGACATCTCCATGATGACTGGCTTTGCTCCAGACACAAAGGACCTGGAACTGCTGGCCTCTGGAGTAGATAGATACATCTCCAAGTACGAGATGAACAAAGCCTTCTCCAACAAGAACACCCTCATCATCTACCTAGAAAAGATTTCACACACCGAAGAAGACTGCCTGACCTTCAAAGTTCACCAGTACTTTAATGTGGGACTTATCCAGCCCGGGTCGGTCAAGGTCTACTCCTATTACAACCTCGAGGAATCATGCACCCGGTTCTATCATCCAGAGAAGGACGATGGGATGCTCAGCAAGCTGTGCCACAGTGAAATGTGCCGGTGTGCTGAAGAGAACTGCTTCATGCAACAGTCACAGGAGAAGATCAACCTGAATGTCCGG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000024164

numer dostępu NCBI

NM_009778

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... C3(12266) , C3(12266)

Opis ogólny

3355 esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Stanowią one heterogeniczną mieszaninę siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także wyświetlić wszystkie dostępne opcje esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
WNS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Eva-Maria Nichols et al.
Kidney international, 88(6), 1314-1322 (2015-07-30)
Abnormal regulation of the complement alternative pathway is associated with C3 glomerulopathy. Complement factor H is the main plasma regulator of the alternative pathway and consists of 20 short consensus repeat (SCR) domains. Although recombinant full-length factor H represents a
Hiroyuki Inoshita et al.
PloS one, 8(11), e78736-e78736 (2013-11-14)
The link between glomerular IgA nephropathy (IgAN) and T helper 2 (Th2) response has been implicated, however, the mechanisms are poorly defined because of the lack of an appropriate model. Here we report a novel murine model characterized by lineage-restricted
Manuela Veglia et al.
American journal of reproductive immunology (New York, N.Y. : 1989), 74(6), 542-552 (2015-09-22)
A threefold higher prevalence of antinuclear antibodies (ANA) has been reported in patients with recurrent pregnancy loss (RPL). Nevertheless, the role of ANA in reproductive failure is still unclear. The aim of this study was to investigate the role of
Maria I Fonseca et al.
Journal of neuroinflammation, 8(1), 4-4 (2011-01-18)
Complement proteins and activation products have been found associated with neuropathology in Alzheimer's disease (AD). Recently, a C5a receptor antagonist was shown to suppress neuropathology in two murine models of AD, Tg2576 and 3xTg. Previously, a genetic deficiency of C1q
Masanori A Murayama et al.
Nature communications, 6, 8483-8483 (2015-09-26)
The complement system is important for the host defence against infection as well as for the development of inflammatory diseases. Here we show that C1q/TNF-related protein 6 (CTRP6; gene symbol C1qtnf6) expression is elevated in mouse rheumatoid arthritis (RA) models.
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej