Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU060181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rnmt

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTTGAGAAGCAGCAGTGAGCACGTTGCTTTAGAGCAGCACTCCATCCTCCCAGGTGGAGCAGACCATCTCAGAAACATTTGACAGCTGTTTGTTTATTTTAATAGTAAGTTCTCAATGTGTAGGATGCTGCCACAAACTTCAGTGTATGAATTTGACACTTACTGTCTGTGACAGGTTAGCATAATGTGTGTACATAGGGATGAGTTGTCTTGAAGATCTATTTTTAAGTACTGTTGTAATTGTTCCCCTCTACTGTCAAAACTCTAGCAAGGCATGTCAGAGCAGCTGACCTCCCCAGTGCTGTGATGTGTGAGCAGCTGACCTCCCCAGTGCTGGGATGTGTGAATGTGTTTACAGAGCTGATTTGACAGTCGCTAGAATTGGCAGAGGAACGTTCAC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000009535

numer dostępu NCBI

NM_026440

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... RNMT(67897) , Rnmt(67897)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jun Liu et al.
Journal of experimental & clinical cancer research : CR, 34, 35-35 (2015-05-01)
Gastric cancer (GC) remains one of the most common types of malignant cancer, and the molecular mechanism underlying its metastasis is still largely unclear. MicroRNAs have emerged as important regulators of metastasis because of their ability to act on multiple
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Katarzyna Miekus et al.
Oncotarget, 6(12), 10086-10101 (2015-04-19)
Cervical cancer is one of the leading causes of death among women suffering from tumors. Current treatment options are insufficient. Here, we investigated the MET receptor as a potential molecular target in advanced cervical cancer. Downregulation of MET receptor expression
Young-Won Kim et al.
PloS one, 10(7), e0134552-e0134552 (2015-08-01)
Previous studies have shown that c-MET is overexpressed in cases of aggressive bladder cancer (BCa). Identification of crosstalk between c-MET and other RTKs such as AXL and PDGFR suggest that c-MET network genes (c-MET-AXL-PDGFR) may be clinically relevant to BCa.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej