Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU050191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp14

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCTCCGAGGAGAGATGTTTGTCTTCAAGGAGCGATGGTTCTGGCGGGTGAGGAATAACCAAGTGATGGATGGATACCCAATGCCCATTGGCCAATTCTGGAGGGGCCTGCCTGCATCCATCAATACTGCCTACGAAAGGAAGGATGGCAAATTTGTCTTCTTCAAAGGAGATAAGCACTGGGTGTTTGACGAAGCCTCCCTGGAACCCGGGTACCCCAAGCACATTAAGGAGCTTGGCCGAGGGCTGCCCACGGACAAGATCGATGCAGCTCTCTTCTGGATGCCCAATGGGAAGACCTACTTCTTCCGGGGCAATAAGTACTACCGGTTCAATGAAGAATTCAGGGCAGTGGACAGCGAGTACCCTAAAAACATCAAAGTCTGGGAAGGAATCCCTGAATCTCCCAGGGGGTCATTCATGGGCAGTGATG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000000957

numer dostępu NCBI

NM_008608

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... MMP14(17387) , Mmp14(17387)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Evelyne Tassone et al.
Journal of cellular physiology, 230(2), 366-377 (2014-07-06)
Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular, and transmembrane proteins. Here
Bi-Sen Ding et al.
Journal of cell science, 128(16), 2983-2988 (2015-06-28)
Human airway basal cells are the stem (or progenitor) population of the airway epithelium, and play a central role in anchoring the epithelium to the basement membrane. The anatomic position of basal cells allows for potential paracrine signaling between them
Naohiko Koshikawa et al.
Cancer research, 75(16), 3327-3339 (2015-07-02)
Eph receptor tyrosine kinases are considered candidate therapeutic targets in cancer, but they can exert opposing effects on cell growth. In the presence of its ligands, Eph receptor EphA2 suppresses signaling by other growth factor receptors, including ErbB, whereas ligand-independent
Dane K Lund et al.
American journal of physiology. Cell physiology, 307(2), C140-C149 (2014-06-06)
The twenty-five known matrix metalloproteases (MMPs) and their endogenous inhibitors, tissue inhibitors of metalloproteases (TIMPs), mediate cell invasion through the extracellular matrix (ECM). In a comparative three-dimensional assay, we analyzed human and mouse satellite cells' competence to invade an artificial

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej