Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU047141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Il1rl1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATTGCCTGTTCAGCTTGCTTTGGCAAAGGCTCTCACTTCTTGGCTGATGTCCTGTGGCAGATTAACAAAACAGTAGTTGGAAATTTTGGTGAAGCAAGAATTCAAGAAGAGGAAGGTCGAAATGAAAGTTCCAGCAATGACATGGATTGTTTAACCTCAGTGTTAAGGATAACTGGTGTGACAGAAAAGGACCTGTCCCTGGAATATGACTGTCTGGCCCTGAACCTTCATGGCATGATAAGGCACACCATAAGACTGAGAAGGAAACAACCAAGTAAGGAGTGTCCCTCACACATTGCTTGAATAAATTGGCTGAATCAGCTGTGCACTGCATCCGTTTTCTCCGAGGACTGTGTGTTGTAGCTTGGTCCCAGGGAATCCATCATGATCAAGGGAATAGTTGGCCTG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000026069

numer dostępu NCBI

NM_010743

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... IL1RL1(17082) , Il1rl1(17082)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xi-Xiang Yu et al.
Digestive diseases and sciences, 60(5), 1265-1272 (2015-02-07)
As a pro-inflammatory cytokine, IL-33 has been demonstrated to play an important role in tumor progression. It is reported that IL-33 is highly expressed in the serum and tumor tissues of patients with gastric cancer. However, the function of IL-33
S Stojkovic et al.
Journal of thrombosis and haemostasis : JTH, 12(6), 948-957 (2014-04-08)
Urokinase-type plasminogen activator (u-PA) plays a pivotal role in extracellular proteolysis and is thought to be critically involved in the modulation of angiogenesis. Interleukin (IL)-33 is a member of the IL-1 cytokine family, which is thought to act as danger
Anne Marie Thompson et al.
American journal of physiology. Heart and circulatory physiology, 307(4), H533-H541 (2014-06-29)
Loss of vascular smooth muscle cell (VSMC) function is a hallmark of vascular disease. VSMCs become increasingly dysregulated, apoptotic, and senescent as we age. Sirtuin 1 (SirT1) is a deactylase that regulates substrates associated with stress mitigation, metabolism, and aging.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej