Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU037431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Syp

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGTGGGTCTTTGCCATCTTCGCCTTTGCTACGTGCGGCAGCTACACCGGAGAGCTTCGGCTGAGCGTGGAGTGTGCCAACAAGACGGAGAGTGCCCTCAACATCGAAGTCGAATTTGAGTACCCATTCAGGCTGCACCAAGTGTACTTTGATGCACCCTCCTGCGTTAAAGGGGGCACTACCAAGATCTTCCTAGTTGGTGACTACTCCTCCTCGGGTGAATTCTTTGTCACCGTGGCTGTGTTTGCCTTCCTCTACTCCATGGGGGCCCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAACAACAAAGGGCCAATGATGGACTTCCTGGCCACAGCAGTGTTCGCTTTCATGTGGCTAGTTAGCTCATCCGCCTGGGCCAAAGGCCTGTCCGATGTGAAGATGGCCACTGACCCAGAGAACATTATCAAGGAGATGCCTATGTGCCGCCAGACAGGAAACACATGCAAGGAACTGAGGGACCCTGT

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000031144

numer dostępu NCBI

NM_009305

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... SYP(20977) , Syp(20977)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hsueh-Chun Wang et al.
BMC cancer, 14, 442-442 (2014-06-17)
Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet
Toru Mitsumori et al.
Experimental hematology, 42(9), 783-792 (2014-05-28)
The hypoxic microenvironment of the bone marrow, known as the hypoxic niche, supports hematopoietic stem cell quiescence and maintains long-term repopulation activity. Hypoxia also affects the expansion of progenitor cells and enhances erythropoiesis and megakaryopoiesis. In contrast to the known
Rong-Ping Zhou et al.
Molecular medicine reports, 11(6), 4489-4495 (2015-01-31)
Chlorogenic acid (CGA) exhibits various biological properties, including the inhibition of oxidation, obesity, apoptosis and tumorigenesis. CGA is also able to promote cell survival and proliferation. The aim of the present study was to determine the effects and underlying molecular
K S Siveen et al.
British journal of cancer, 111(7), 1327-1337 (2014-08-08)
Constitutive activation of signal transducer and activator of transcription signalling 3 (STAT3) has been linked with survival, proliferation and angiogenesis in a wide variety of malignancies including hepatocellular carcinoma (HCC). We evaluated the effect of lupeol on STAT3 signalling cascade

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej