Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU036901

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Scarb1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCAAATTTGGCCTGTTTGTTGGGATGAACAACTCGAATTCTGGGGTCTTCACTGTCTTCACGGGCGTCCAGAATTTCAGCAGGATCCATCTGGTGGACAAATGGAACGGACTCAGCAAGATCGATTATTGGCATTCAGAGCAGTGTAACATGATCAATGGGACTTCCGGGCAGATGTGGGCACCCTTCATGACACCCGAATCCTCGCTGGAATTCTTCAGCCCGGAGGCATGCAGGTCCATGAAGCTGACCTACAACGAATCAAGGGTGTTTGAAGGCATTCCCACGTATCGCTTCACGGCCCCCGATACTCTGTTTGCCAACGGGTCCGTCTACCCACCCAACGAAGGCTTCTGCCCATGCCGAGAGTCTGGCATTCAGAATGTCAGCACCTGCAGGTTTGGTGCGCCTCTGTTTCTCTCCCACCCCCACTTTTACAACGCCGACCCTGTGTTGTCAGAAGCTGTTCTTGGTCTGAACCCTAACCCAAAGGAGC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000037936

numer dostępu NCBI

NM_016741

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... SCARB1(20778) , Scarb1(20778)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Laeticia Lichtenstein et al.
Cardiovascular research, 106(2), 314-323 (2015-03-15)
High-density lipoproteins (HDLs) protect against atherosclerosis mainly due to their function in hepatobiliary reverse cholesterol transport (RCT). This is a process whereby excess cholesterol from peripheral tissues is transported by HDL particles to the liver for further metabolism and biliary
Georgia Schäfer et al.
PloS one, 4(12), e8448-e8448 (2009-12-31)
The interaction between Mycobacterium tuberculosis (Mtb) and host cells is complex and far from being understood. The role of the different receptor(s) implicated in the recognition of Mtb in particular remains poorly defined, and those that have been found to
Pin Yue et al.
PloS one, 5(3), e9906-e9906 (2010-04-03)
CD36 facilitates oxidized low density lipoprotein uptake and is implicated in development of atherosclerotic lesions. CD36 also binds unmodified high and very low density lipoproteins (HDL, VLDL) but its role in the metabolism of these particles is unclear. Several polymorphisms
Xia Chu et al.
Molecular nutrition & food research, 59(8), 1491-1503 (2015-05-07)
Ursolic acid (UA) is a triterpenoid compound with multifold biological functions. Our previous studies have reported that UA protects against high-fat diet-induced obesity and improves insulin resistance (IR). However, the potential mechanisms are still undefined. Free fatty acid (FFA) metabolism
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej