Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU033061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ereg

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGCTGCTTTGTCTAGGTTCCCACCTTCTACAGGCAGTTATCAGCACAACCGTGATCCCATCATGCATCCCAGGAGAATCCGAGGATAACTGTACCGCCTTAGTTCAGATGGAAGACGATCCCCGTGTGGCTCAAGTGCAGATTACAAAGTGTAGTTCTGACATGGACGGCTACTGCTTGCATGGCCAGTGCATCTACCTGGTGGACATGAGAGAGAAATTCTGCAGATGTGAAGTGGGCTACACTGGTCTGCGATGTGAGCACTTCTTTCTAACTGTTCACCAACCCTTGAGCAAAGAATACGTTGCGTTGACAGTGATTCTCATTTTCCTGTTTCTCATCATAACCGCTGGATGCATATACTATTTCTGCAGATGGTACAAAAATCGAAAAAGTAAAAAATCGAGGGAGGAATATGAGAGAGTGACCTCAGGGGACCCAGTGCTGCCACAGGTCTGAACAGTGCCATCAAGTTACGGA

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

3355 esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Stanowią one heterogeniczną mieszaninę siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także wyświetlić wszystkie dostępne opcje esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Teresa Elo et al.
Endocrine-related cancer, 21(4), 677-690 (2014-06-19)
Estrogens contribute to the development and growth of the prostate and are implicated in prostate tumorigenesis. In their target tissues, estrogens mediate their effects via estrogen receptor α (ERα (ESR1)) and β (ERβ (ESR2)). Hyperplasia and decreased differentiation of epithelial
Mariya Farooqui et al.
Molecular cancer, 14, 138-138 (2015-07-29)
The epidermal growth factor (EGF) family of ligands has been implicated in promoting breast cancer initiation, growth and progression. The contributions of EGF family ligands and their receptors to breast cancer are complex, and the specific mechanisms through which different
Renlong Zou et al.
International journal of biological sciences, 11(9), 992-1005 (2015-07-30)
Estrogen receptor α (ERα) is a key transcriptional factor in the proliferation and differentiation in mammary epithelia and has been determined to be an important predictor of breast cancer prognosis and therapeutic target. Meanwhile, diverse transcriptional co-regulators of ERα play
Ming-Yue Li et al.
Journal of molecular medicine (Berlin, Germany), 93(11), 1221-1233 (2015-06-05)
Smoking carcinogen N-nitrosamines such as 4-methylnitrosamino-l-3-pyridyl-butanone (NNK) require metabolic activation to exert their genotoxicity. The first activation step is mainly catalyzed by cytochrome P450 (CYP) family. Estrogen receptor α (ERα) plays a role in lung pathology. The association between them
Shang Li et al.
Scientific reports, 5, 16815-16815 (2015-11-17)
Formononetin is an isoflavone that has been shown to display estrogenic properties and induce angiogenesis activities. However, the interrelationship between the estrogenic properties and angiogenesis activities of formononetin are not well defined. In the present study, docking and enzymatic assay

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej