Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU021051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnfrsf10b

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCAGTGCGTTTGAAGTCAGCCTGATCTACTTAGTGAACTCAGGACAGCCAAGGCTATGTAGAGAGCCCCGAAGATGCAGGCTCTTCAGTATTATGAGAATGTACTTAATTTTTTCTTGTAGTAGTTAGTGTATCATATTATTGTATTATTTATATTATTACTGTTAAGTACTATGTTCTCTTATTAGAAGTTGAACACAGAACCTCTGAGAACACATATGCTACAAGTGTTCTAACACACCTCCAGCATCCCGGATTACCTTTGTTCCTGAACAAGGCACAATTGGTAGGGTATGATAGGGCCTGCCTATCATCCTAACACTCCGGTGATGGAGCCAGGAAGATCAAGAGTTCGAGGCCAGCTGGTTCACATAAGATCCCATATAATGTGCAGGATGGCTAAACTTGCTGAGAGCTGACTCTGTGGTCTCCTGTCCCAGATTC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000022074

numer dostępu NCBI

NM_020275

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... TNFRSF10B(21933) , Tnfrsf10b(21933)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hemn Mohammadpour et al.
Photodiagnosis and photodynamic therapy, 12(2), 238-243 (2015-02-28)
Mesenchymal stem cells are multi-potent progenitor cells that inhibit tumor growth by some ligands and releasing factors including TRAIL, DKK-1 and DKK-3. On other hands, photodynamic therapy is commonly used for treatment of different types of cancer. The aims of
Deokil Shin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(3), 1151-1162 (2015-06-27)
Although Vitisin A, derived from wine grapes, is known to have cytotoxic, anti-adipogenic, anti-inflammatory and antioxidant effects, the underlying antitumor mechanism has not been investigated in prostate cancer cells to date. In the present study, the apoptotic mechanism of Vitisin
Huilian Huang et al.
Clinical laboratory, 61(10), 1501-1508 (2015-12-09)
Mounting evidence indicates that nuclear targeting by growth factors plays an indispensable role on their biological activities. Midkine (MK) is a multifunctional growth factor and has been discovered to play important roles in carcinogenesis. MK has been reported to localize
Jiahe Li et al.
Scientific reports, 5, 9987-9987 (2015-05-20)
Malignant transformation results in increased levels of reactive oxygen species (ROS). Adaption to this toxic stress allows cancer cells to proliferate. Recently, piperlongumine (PL), a natural alkaloid, was identified to exhibit novel anticancer effects by targeting ROS signaling. PL induces
Seon Min Woo et al.
Oncotarget, 6(13), 11614-11626 (2015-04-07)
FTY720, Fingolimod, is a functional antagonist to the sphingosine-1-phosphate (S1P) receptor and an inhibitor of sphingosine kinase 1. Here, we showed that a combination of FTY720 and TRAIL induced apoptosis in human renal, breast, and colon carcinoma cells. Most importantly

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej