Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU020861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd276

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GACCAGGATGGAGATGGAGAAGGATCCAAGACAGCTCTACGGCCTCTGAAACCCTCTGAAAACAAAGAAGATGACGGACAAGAAATTGCTTGATTGGGAGCTGCTGCCCTTCCCAGGTGGGGGGCCCACCCTCTGGCAGTGTTGAGCTTCAATGCGAGCCCTTCCCCCCAACGAATGGGTTTGTCCCACAGATCTACCCGTTCGTCAAAGGACGTGGTCCATAGACCACCCACAGCCTTACTTTTCCAATGGACTTAATTCCCATCATCCTGCAGCCTCATTTCTCCAGTGACACGATACACGAACCATCCTGCGGCCTTATTTCCCACGGACACGACACAAAGATGTCCCTCCTCGGTGTTCCTCCAGAGTCGTCTGGTGGCCTTGTGATACGGCGTGAACCTTCTTCCTTCTGCCTTACGTCTAATGGACACACACGCACC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000035914

numer dostępu NCBI

NM_133983

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... CD276(102657) , Cd276(102657)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Feifei Wang et al.
Cancer investigation, 32(6), 262-271 (2014-05-03)
B7-H3 has been detected in different cancers and correlated to tumor progression and outcome in cancer patients. In this study, we investigated the expression of B7-H3 in tissues and cells of primary hepatocellular carcinoma (PHC) patients. The research showed that
Wei Zhang et al.
OncoTargets and therapy, 8, 1721-1733 (2015-07-24)
The role of B7-H3 in acute monocytic leukemia U937 cells has not been thoroughly investigated. B7-H3 knockdown in the U937 cell line was performed using small hairpin (sh)RNA lentivirus transduction. The effects on cell proliferation, cycle, migration, and invasion were
Fu-Biao Kang et al.
Cancer cell international, 15, 45-45 (2015-04-25)
B7-homologue 3 (B7-H3), a recently identified immunoregulatory protein, has been shown to be overexpressed in human hepatocellular carcinoma (HCC). However, whether the dynamic expression pattern of B7-H3 contributes to early invasion of HCC is largely unknown. In addition, the biological

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej