Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU011371

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATGGCCAACTCGTTTGTAGGGACGCGCTCCTACATGTCCCCAGAGCGGCTGCAGGGCACCCACTACTCTGTGCAGTCGGACATCTGGAGCATGGGGCTGTCGCTGGTGGAGCTGGCCATCGGGAGGTATCCCATTCCCCCACCTGATGCCAAGGAACTAGAGGCCAGCTTTGGCCGGCCTGTGGTGGACGGGGCAGACGGAGAACCCCATAGTGTCTCCCCGAGGCCCAGGCCCCCTGGACGCCCCATCAGTGTAGGTCATGGGATGGACAGCCGACCGGCCATGGCCATCTTTGAGCTGCTGGACTACATAGTGAACGAGCCACCTCCCAAGCTGCCCAGTGGTGTGTTCAGCTCAGACTTCCAGGAGTTTGTGAATAAATGTCTCATTAAGAACCCAGCAGAGCGAGCAGATCTGAAGC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000035027

numer dostępu NCBI

NM_023138

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... MAP2K2(26396) , Map2k2(26396)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

12 - Non Combustible Liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Simona Gargiulo et al.
International journal of molecular sciences, 13(11), 14278-14293 (2012-12-04)
The hypercholesterolemia-atherosclerosis association is now established; hypercholesterolemia may induce vascular-cell activation, subsequently increasing expression of adhesion molecules, cytokines, chemokines, growth factors, and other key inflammatory molecules. Among inflammatory molecules expressed by vascular cells, integrins play a critical role in regulating
Sara Alves et al.
Oncotarget, 6(31), 30787-30802 (2015-09-30)
The recent interest to modulate autophagy in cancer therapy has been hampered by the dual roles of this conserved catabolic process in cancer, highlighting the need for tailored approaches. Since RAS isoforms have been implicated in autophagy regulation and mutation
Caroline N Mills et al.
Molecular cancer, 8, 104-104 (2009-11-19)
Hypoxia inducible factor-1 alpha (HIF-1alpha) protein is rapidly degraded under normoxic conditions. When oxygen tensions fall HIF-1alpha protein stabilizes and transactivates genes involved in adaptation to hypoxic conditions. We have examined the normoxic expression of HIF-1alpha RNA and protein in
Lei-Lei Chen et al.
Autophagy, 13(11), 1969-1980 (2017-09-22)
Recent studies have demonstrated that dysregulation of macroautophagy/autophagy may play a central role in the pathogenesis of neurodegenerative disorders, and the induction of autophagy protects against the toxic insults of aggregate-prone proteins by enhancing their clearance. Thus, autophagy has become
Kazutaka Nanba et al.
Endocrinology, 156(5), 1750-1756 (2015-02-14)
There is considerable evidence supporting the role of calcium signaling in adrenal regulation of both aldosterone synthase (CYP11B2) and aldosterone production. However, there have been no studies that investigated the role played by the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK) in
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej