Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU007831

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Birc2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTGTGTTCATTCCGTGTGGTCATCTAGTAGTCTGCCAGGAATGTGCCCCTTCTCTAAGGAAGTGCCCCATCTGCAGGGGGACAATCAAGGGGACTGTGCGCACATTTCTCTCATGAGTGAAGAATGGTCTGAAAGTATTGTTGGACATCAGAAGCTGTCAGAACAAAGAATGAACTACTGATTTCAGCTCTTCAGCAGGACATTCTACTCTCTTTCAAGATTAGTAATCTTGCTTTATGAAGGGTAGCATTGTATATTTAAGCTTAGTCTGTTGCAAGGGAAGGTCTATGCTGTTGAGCTACAGGACTGTGTCTGTTCCAGAGCAGGAGTTGGGATGCTTGCTGTATGTCCTTCAGGACTTCTTGGATTTGGAATTTGTGAAAGCTTTGGATTCAGGTGATGTGGAGCTCAGA

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

M Lappas
Placenta, 35(10), 831-838 (2014-08-13)
Independent of their role in apoptosis, cellular inhibitors of apoptosis (cIAP) 1 and 2, have emerged as regulators of inflammation. Obesity in pregnancy is characterised by maternal and placental inflammation. Thus, the aim of this study was to determine the
Hong Jin et al.
Oncology research, 22(3), 167-176 (2015-07-15)
Emerging evidence suggests a potential role of cellular inhibitor of apoptosis protein 1 (cIAP1) in the development of human ovarian cancer. However, its function in the progression of ovarian cancer has not been clearly determined. Our study aimed to investigate
E-W Lee et al.
Cell death and differentiation, 22(9), 1463-1476 (2015-01-24)
Given their crucial role in apoptosis suppression, inhibitor of apoptosis proteins (IAPs) have recently become attractive targets for cancer therapy. Here, we report that cellular IAP2 (cIAP2) is specifically stabilized in several cancer cell lines, leading to resistance to Smac

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej