Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU158481

Sigma-Aldrich

MISSION® esiRNA

targeting human CHEK2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGTCCTCTCACTCCAGCTCTGGGACACTGAGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCTGAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAGGATGGATTTGCCAATCTTGAATGTGTGAATGACAACTACTGGTTTGGGAGGGACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGAACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATTGCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAAGGAAAACGCCGTCCTTTGAAT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000183765

numer dostępu NCBI

NM_001005735

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CHEK2(11200) , CHEK2(11200)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Thomas Ströbel et al.
Scientific reports, 7(1), 9674-9674 (2017-08-31)
Ape1 is the major apurinic/apyrimidinic (AP) endonuclease activity in mammalian cells, and a key factor in base-excision repair of DNA. High expression or aberrant subcellular distribution of Ape1 has been detected in many cancer types, correlated with drug response, tumor
Wei Liu et al.
Oncotarget, 9(1), 346-360 (2018-02-09)
Despite advances in deciphering the molecular pathogenesis of diffuse large B-cell lymphoma (DLBCL), patients with relapsed/refractory disease, particularly those with adverse genetic features (e.g., mutated p53 or double hit lymphoma (DHL)) have very poor prognoses, and effective therapies are lacking.
T-Y Chen et al.
Oncogenesis, 4, e180-e180 (2015-12-23)
The antitumor drug etoposide (ETO) is widely used in treating several cancers, including adrenocortical tumor (ACT). However, when used at sublethal doses, tumor cells still survive and are more susceptible to the recurring tumor due to centrosome amplification. Here, we
Svasti Haricharan et al.
Cancer discovery, 7(10), 1168-1183 (2017-08-13)
Significant endocrine therapy-resistant tumor proliferation is present in ≥20% of estrogen receptor-positive (ER+) primary breast cancers and is associated with disease recurrence and death. Here, we uncover a link between intrinsic endocrine therapy resistance and dysregulation of the MutL mismatch
Yuping Chen et al.
Science advances, 6(1), eaax5819-eaax5819 (2020-01-09)
Autophagy is an evolutionarily conserved catabolic process, which plays a vital role in removing misfolded proteins and clearing damaged organelles to maintain internal environment homeostasis. Here, we uncovered the checkpoint kinase 2 (CHK2)-FOXK (FOXK1 and FOXK2) axis playing an important
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej