Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU156781

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCGAGGTCATTACGCTCTTCACTGGGGTCCTGTTCTTCTTCACCAACATCAAAGACTTGTTCATGAAGAAATGCCCTGGAGTGAATTCTCTCTTCATTGATGGCTCCTTCCAGCTGCTCTACTTCATCTACTCTGTCCTGGTGATCGTCTCAGCAGCCCTCTACCTGGCAGGGATCGAGGCCTACCTGGCCGTGATGGTCTTTGCCCTGGTCCTGGGCTGGATGAATGCCCTTTACTTCACCCGTGGGCTGAAGCTGACGGGGACCTATAGCATCATGATCCAGAAGATTCTCTTCAAGGACCTTTTCCGATTCCTGCTCGTCTACTTGCTCTTCATGATCGGCTACGCTTCAGCCCTGGTCTCCCTCCTGAACCCGTGTGCCAACATGAAGGTGTGCAATGAGGACCAGACCAACTGCACAGTGCCCACTTACCCCTCGTGCCGTGACAGCGAGACCTTCAGCACCTTCCTCCTGGACCTGTT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000111199

numer dostępu NCBI

NM_021625

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TRPV4(59341) , TRPV4(59341)

Opis ogólny

MISSION esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Są one heterogeniczną mieszaniną siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także zapoznać się ze wszystkimi dostępnymi opcjami esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
LWT
HVT
JRT
WNS
TMS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yuanzheng Gu et al.
The Journal of cell biology, 216(7), 2179-2199 (2017-06-14)
Little is known about mechanical regulation of morphological and functional polarity of central neurons. In this study, we report that mechanical stress specifically induces varicosities in the axons but not the dendrites of central neurons by activating TRPV4, a Ca
Hengli Zhao et al.
Frontiers in molecular neuroscience, 11, 97-97 (2018-04-11)
Blood-brain barrier (BBB) disruption and subsequent brain edema play important roles in the secondary neuronal death and neurological dysfunction that are observed following intracerebral hemorrhage (ICH). In previous studies, transient receptor potential vanilloid 4 (TRPV4), a calcium-permeable mechanosensitive channel, was
Bo Xu et al.
Life sciences, 228, 158-166 (2019-05-06)
Chondrocyte apoptosis is the most common pathological feature of cartilage in osteoarthritis (OA). Excessive mechanical stress can induce chondrocyte apoptosis and destroy cartilage tissue. Transient receptor potential channel vanilloid 4 (TRPV4) is a mechanosensitive ion channel that mediates chondrocyte response
Boran Cao et al.
Journal of cellular physiology, 234(5), 6831-6841 (2018-11-06)
The aim of this study is to evaluate the effect of transient receptor potential vanilloid 4 (TRPV4) on osteoclast differentiation and osteoporosis, and to investigate the underlying mechanism. The results showed that TRPV4 expression and intracellular Ca2+ concentration were significantly
Tatsuya Ihara et al.
Neurourology and urodynamics, 37(8), 2535-2543 (2018-08-15)
The sensation of bladder fullness (SBF) is triggered by the release of ATP. Therefore, the aim of this study was to investigate whether time-dependent changes in the levels of stretch-released ATP in mouse primary-cultured urothelial cells (MPCUCs) is regulated by
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej