Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU155921

Sigma-Aldrich

MISSION® esiRNA

targeting human LOX

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCCAAAGAGTGAAAAACCAAGGGACATCAGATTTCTTACCCAGCCGACCAAGATATTCCTGGGAATGGCACAGTTGTCATCAACATTACCACAGTATGGATGAGTTTAGCCACTATGACCTGCTTGATGCCAACACCCAGAGGAGAGTGGCTGAAGGCCACAAAGCAAGTTTCTGTCTTGAAGACACATCCTGTGACTATGGCTACCACAGGCGATTTGCATGTACTGCACACACACAGGGATTGAGTCCTGGCTGTTATGATACCTATGGTGCAGACATAGACTGCCAGTGGATTGATATTACAGATGTAAAACCTGGAAACTATATCCTAAAGGTCAGTGTAAACCCCAGCTACCTGGTTCCTGAATCTGACTATACCAACAATGTTGTGCGCTGTGACAT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

D H Peng et al.
Oncogene, 36(14), 1925-1938 (2016-10-04)
Lung cancer is the leading cause of cancer-related deaths, primarily due to distant metastatic disease. Metastatic lung cancer cells can undergo an epithelial-to-mesenchymal transition (EMT) regulated by various transcription factors, including a double-negative feedback loop between the microRNA-200 (miR-200) family
T Osawa et al.
British journal of cancer, 109(8), 2237-2247 (2013-09-21)
Molecules that are highly expressed in tumour endothelial cells (TECs) may be candidates for specifically targeting TECs. Using DNA microarray analysis, we found that the lysyl oxidase (LOX) gene was upregulated in TECs compared with its expression in normal endothelial
Roozbeh Khosravi et al.
PloS one, 9(6), e100669-e100669 (2014-06-28)
Lysyl oxidase is a multifunctional enzyme required for collagen biosynthesis. Various growth factors regulate lysyl oxidase during osteoblast differentiation, subject to modulation by cytokines such as TNF-α in inflammatory osteopenic disorders including diabetic bone disease. Canonical Wnt signaling promotes osteoblast
Rolf Schreckenberg et al.
Frontiers in physiology, 8, 556-556 (2017-08-22)
Purpose: According to the current therapeutic guidelines of the WHO physical activity and exercise are recommended as first-line therapy of arterial hypertension. Previous results lead to the conclusion, however, that hearts of spontaneously hypertensive rats (SHR) with established hypertension cannot
Roseli da Silva et al.
PloS one, 10(3), e0119781-e0119781 (2015-03-20)
Lysyl oxidase (LOX) is involved in vital biological processes such as cell motility, cell signaling and gene regulation. Deregulation of this protein can contribute to tumor formation and progression. Although it is known that LOX is involved in invasion, proliferation

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej