Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU155731

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR7

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCCAGGTATGCCTGTGTCAAGATGAGGTCACGGACGATTACATCGGAGACAACACCACAGTGGACTACACTTTGTTCGAGTCTTTGTGCTCCAAGAAGGACGTGCGGAACTTTAAAGCCTGGTTCCTCCCTATCATGTACTCCATCATTTGTTTCGTGGGCCTACTGGGCAATGGGCTGGTCGTGTTGACCTATATCTATTTCAAGAGGCTCAAGACCATGACCGATACCTACCTGCTCAACCTGGCGGTGGCAGACATCCTCTTCCTCCTGACCCTTCCCTTCTGGGCCTACAGCGCGGCCAAGTCCTGGGTCTTCGGTGTCCACTTTTGCAAGCTCATCTTTGCCATCTACAAGATGAGCTTCTTCAGTGGCATGCTCCTACTTCTTTGCATCAGCATTGACC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Pelin Kaya et al.
Nutrients, 11(2) (2019-02-20)
Curcumae radix is the dry root of Curcuma longa L. (turmeric) that can be used either as a spice or traditional medicine. The aim of this study was to investigate the survival benefits and the anti-metastatic activity of curcumae radix
Bing Xu et al.
Cancer medicine, 6(5), 1062-1071 (2017-04-06)
Chemokine and the chemokine receptor have a key role in the tumor progress. Here, we supposed that CCR7 might induce the invasion, migration, and epithelial-mesenchymal transition (EMT) process of breast cancer. In this research, human breast cancer MCF-7 and MDA-MB-231cells
Lin-Hui Yuan et al.
International journal of ophthalmology, 10(6), 862-869 (2017-07-22)
To investigate the role of CCR7/p-ERK1/2/VEGF signaling in the mouse model of oxygen-induced retinopathy (OIR). Neonatal C57BL/6J mice were evenly randomized into four groups: normoxia, OIR, OIR control (treated with scramble siRNA), and OIR treated (treated with CCR7 siRNA). Normoxia
Fei Li et al.
Medical oncology (Northwood, London, England), 31(9), 180-180 (2014-08-22)
Secondary lymphoid tissue chemokine (SLC/CCL21) and its receptor CCR7 have been implicated in lymph node metastasis, whereas the mechanism of which remains unclear. Epithelial-mesenchymal transition (EMT) plays an important role in invasion and migration of cancer cells. We presumed that
Kaori Kubo et al.
Biochemical and biophysical research communications, 463(4), 825-831 (2015-06-24)
Chronic myeloid leukemia is a clonal disease characterized by the presence of the Philadelphia chromosome and its oncogenic product, BCR-ABL, which activates multiple pathways involved in cell survival, growth promotion, and disease progression. We previously reported that in murine hematopoietic

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej