Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU154181

Sigma-Aldrich

MISSION® esiRNA

targeting human NOL3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AAGGGACGAGTCCGAAGATTCCTGAAGGCCAGAGCTCTGACAGGCGGTGCCCCGCCCATGCTGGATAGGACCTGGGATGCTGCTGGAGCTGAATCGGATGCCACCAAGGCTCGGTCCAGCCCAGTACCGCTGGAAGTGAATAAACTCCGGAGGGTCGGACGGGACCTGGGCTCTCTCCACGATTCTGGCTGTTTGCCCAGGAACTTAGGGTGGGTACCTCTGAGTCCCAGGGACCTGGGCAGGCCCAAGCCCACCACGAGCATCATCCAGTCCTCAGCCCTAATCTGCCCTTAGGAGTCCAGGCTGCACCCTGGAGATCCCAAACCTAGCCCCCTAGTGGGACAAGGACCTGACCCTCCTGCCCGCATACACAACCCATTTCCCCTGGTGAGCCACTTGGCAGCATATGTAGGTACCAGCTCAACCCCACGCAAGTTCCTGAGCTGAACATGGAGCAAGGGGAGGGTGACTTCTCTCCACATAGGGAGGGCTTAGAGCTCACAGCCTTGGGAAGTGAGACTAGAAGAGGGGAGCAGAAAGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000140939

numer dostępu NCBI

NM_003946

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... NOL3(8996) , NOL3(8996)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
LSS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Csaba Toth et al.
Cell communication and signaling : CCS, 15(1), 16-16 (2017-05-04)
Renal cell carcinomas (RCCs) display broad resistance against conventional radio- and chemotherapies, which is due at least in part to impairments in both extrinsic and intrinsic apoptotic pathways. One important anti-apoptotic factor that is strongly overexpressed in RCCs and known
Fang Xie et al.
Acta physiologica (Oxford, England), 228(2), e13337-e13337 (2019-07-02)
Cardiac hypertrophy and myocardial apoptosis are two major factors in heart failure. As a classical regulator of apoptosis, apoptosis repressor with caspase recruitment domain (ARC) has recently also been found to have a protective effect against hypertrophy. However, the mechanism
Christopher DeBoever et al.
Nature communications, 9(1), 1612-1612 (2018-04-25)
Protein-truncating variants can have profound effects on gene function and are critical for clinical genome interpretation and generating therapeutic hypotheses, but their relevance to medical phenotypes has not been systematically assessed. Here, we characterize the effect of 18,228 protein-truncating variants
David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej