Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU153671

Sigma-Aldrich

MISSION® esiRNA

targeting human PTX3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATTCAGAGGAAGGGCTCACATCCTTGTGGGTAAATGGTGAACTGGCGGCTACCACTGTTGAGATGGCCACAGGTCACATTGTTCCTGAGGGAGGAATCCTGCAGATTGGCCAAGAAAAGAATGGCTGCTGTGTGGGTGGTGGCTTTGATGAAACATTAGCCTTCTCTGGGAGACTCACAGGCTTCAATATCTGGGATAGTGTTCTTAGCAATGAAGAGATAAGAGAGACCGGAGGAGCAGAGTCTTGTCACATCCGGGGGAATATTGTTGGGTGGGGAGTCACAGAGATCCAGCCACATGGAGGAGCTCAGTATGTTTCATAAATGTTGTGAAACTCCACTTGAAGCCAAAGAAAGAAACTCACACTTAAAACACATGCCAGTTGGGAAGGTCTGAAAACTCAGTGCATAATAGGAACACTTGAGACTAATGAAAGAGAGAGTTGAGACCAATCTTTATTTGTACTGGCCAAATACTGAATAAACAGTTGAAGGAAAGACATTGGAAAAAGCTTTTGAGGATAATGTTACTAGACTTTATGCCATGGTGCTTTCA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Christina L O'Neill et al.
Cardiovascular research, 112(3), 677-688 (2016-09-24)
Circulating angiogenic cells (CACs) promote revascularization of ischaemic tissues although their underlying mechanism of action and the consequences of delivering varying number of these cells for therapy remain unknown. This study investigates molecular mechanisms underpinning CAC modulation of blood vessel
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Xian-Yuan Luo et al.
Cell biology international (2018-05-10)
MicroRNAs (miRNAs) have been known to function as important regulators in the vascular system, with various physiopathological effects such as vascular remodeling and hypertension modulation. We aimed to explore whether microRNA-150 (miR-150) regulates endothelial cell function and vascular remodeling in
Yeon Kim et al.
International journal of molecular sciences, 20(22) (2019-11-21)
Pentraxin-3 (PTX3) is recognized as a modulator of inflammation and a mediator of tissue repair. In this study, we characterized the role of PTX3 on some biological functions of human dental pulp stem cells (HDPSCs). The expression level of PTX3
Narae Hwang et al.
International journal of molecular sciences, 20(23) (2019-12-05)
: (1) Background: Age-related macular degeneration (AMD) is closely related with retinal pigment epithelial (RPE) cell dysfunction. Although the exact pathogenesis of AMD remains largely unknown, oxidative stress-induced RPE damage is believed to be one of the primary causes. We

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej