Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU153321

Sigma-Aldrich

MISSION® esiRNA

targeting human CCND1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiaohong Jiang et al.
Gene therapy, 27(12), 557-566 (2020-06-07)
LncRNAs are reported to participate in the progression of various diseases including diabetic nephropathy. Currently, we reported that SNHG16 was obviously upregulated in db/db mice and high glucose-treated mice mesangial cells. Then, functional experiments showed that SNHG16 silencing significantly inhibited
Dexin Yin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(4), 1499-1511 (2018-09-12)
Recent studies have suggested that several lncRNAs contribute to the angiogenic function of endothelial cells. Herein, we set out to reveal whether lncRNA UCA1 has functions in endothelial angiogenesis. The expression levels of lncRNA UCA1, miR-195 and CCND1 in human
Mingming Wang et al.
Journal of cellular physiology, 235(2), 1588-1600 (2019-07-17)
Prostate cancer (PCa) is one of the major health problems of the aging male. The roles of dysregulated microRNAs in PCa remain unclear. In this study, we mined the public published data and found that miR-487a-3p was significantly downregulated in
Chuanyong Wu et al.
Journal of Cancer, 11(7), 1959-1967 (2020-03-21)
Accumulating evidences showed that aberrantly expressed long noncoding RNAs (lncRNAs) have critical roles in many cancers. However, the expression and roles of a poorly studied lncRNA PCNA-AS1 in non-small-cell lung cancer (NSCLC) remain unknown. In this study, we investigated the
Outhiriaradjou Benard et al.
Molecular cancer research : MCR, 17(7), 1571-1581 (2019-04-11)
Cancer stem cells (CSC) generate and sustain tumors due to tumor-initiating potential, resulting in recurrence or metastasis. We showed that knockout of the cell-cycle inhibitor, p21CIP1, in the PyMT mammary tumor model inhibits metastasis; however the mechanism remained unknown. Here

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej