Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU152001

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP14

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCAGAAGTTTTACGGCTTGCAAGTAACAGGCAAAGCTGATGCAGACACCATGAAGGCCATGAGGCGCCCCCGATGTGGTGTTCCAGACAAGTTTGGGGCTGAGATCAAGGCCAATGTTCGAAGGAAGCGCTACGCCATCCAGGGTCTCAAATGGCAACATAATGAAATCACTTTCTGCATCCAGAATTACACCCCCAAGGTGGGCGAGTATGCCACATACGAGGCCATTCGCAAGGCGTTCCGCGTGTGGGAGAGTGCCACACCACTGCGCTTCCGCGAGGTGCCCTATGCCTACATCCGTGAGGGCCATGAGAAGCAGGCCGACATCATGATCTTCTTTGCCGAGGGCTTCCATGGCGACAGCACGCCCTTCGATGGTGAGGGCGGCTTCCTGGCCCATGCCTACTTCCCAGGCCCCAACATTGGAGGAGACACCCACT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000157227

numer dostępu NCBI

NM_004995

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MMP14(4323) , MMP14(4323)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Po-Hsiang Chang et al.
Scientific reports, 8, 45751-45751 (2017-04-04)
Cancer stem cells (CSCs), a small population of cancer cells, have been considered to be the origin of cancer initiation, recurrence, and metastasis. Tumor microenvironment provides crucial signals for CSCs to maintain stem cell properties and promotes tumorigenesis. Therefore, establishment
Shawn P Carey et al.
Scientific reports, 7, 42088-42088 (2017-02-12)
A critical step in breast cancer progression is local tissue invasion, during which cells pass from the epithelial compartment to the stromal compartment. We recently showed that malignant leader cells can promote the invasion of otherwise non-invasive epithelial follower cells
Pirita Pekkonen et al.
eLife, 7 (2018-05-02)
Lymphatic invasion and lymph node metastasis correlate with poor clinical outcome in melanoma. However, the mechanisms of lymphatic dissemination in distant metastasis remain incompletely understood. We show here that exposure of expansively growing human WM852 melanoma cells, but not singly
Evelyne Tassone et al.
Journal of cellular physiology, 230(2), 366-377 (2014-07-06)
Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular, and transmembrane proteins. Here
Bi-Sen Ding et al.
Journal of cell science, 128(16), 2983-2988 (2015-06-28)
Human airway basal cells are the stem (or progenitor) population of the airway epithelium, and play a central role in anchoring the epithelium to the basement membrane. The anatomic position of basal cells allows for potential paracrine signaling between them
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej