Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU151801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGAAGGATCTCGGCCAATTTGGGGTTTTGGGTTTTGGCTTCGTTTCTTCTCTTCGTTGACTTTGGGGTTCAGGTGCCCCAGCTGCTTCGGGCTGCCGAGGACCTTCTGGGCCCCCACATTAATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000136826

numer dostępu NCBI

NM_004235

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... KLF4(9314) , KLF4(9314)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
NAV
UTU
ITU
JQU
AJU

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Bing Li et al.
Human gene therapy, 30(3), 339-351 (2018-09-13)
Kallistatin (KS) has been recognized as a plasma protein with anti-inflammatory functions. Macrophages are the primary inflammatory cells in atherosclerotic plaques. However, it is unknown whether KS plays a role in macrophage development and the pathogenesis of atherosclerosis. This study
Hong Lok Lung et al.
Scientific reports, 9(1), 12064-12064 (2019-08-21)
We and others have previously shown that the canonical nuclear factor kappa-B (NF-κB) pathway is essential to nasopharyngeal carcinoma (NPC) tumor development and angiogenesis, suggesting that the NF-κB pathway, including its upstream modulators and downstream effectors, are potential therapeutic targets
Guodong Tang et al.
Oncotarget, 7(49), 81757-81767 (2016-11-12)
In this study, our findings indicated that FOXO1 expression frequently decreased in glioma tissues and cells. FOXO1 expression decrease correlated with glioma progression and predicted a worse overall survival of glioma patients. Restored FOXO1 expression inhibited glioma cells invasion and
Scott Bell et al.
American journal of human genetics, 104(5), 815-834 (2019-04-30)
We identified individuals with variations in ACTL6B, a component of the chromatin remodeling machinery including the BAF complex. Ten individuals harbored bi-allelic mutations and presented with global developmental delay, epileptic encephalopathy, and spasticity, and ten individuals with de novo heterozygous
Maisa C Takenaka et al.
Nature neuroscience, 22(5), 729-740 (2019-04-10)
Tumor-associated macrophages (TAMs) play an important role in the immune response to cancer, but the mechanisms by which the tumor microenvironment controls TAMs and T cell immunity are not completely understood. Here we report that kynurenine produced by glioblastoma cells
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej