Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU149811

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGTGTGGGCTTTTTCCCTTTTTTGCTCCTTTTCATTACCCCTCCTCCGTTTTCACCCTTCTCCGGACTTCGCGTAGAACCTGCGAATTTCGAAGAGGAGGTGGCAAAGTGGGAGAAAAGAGGTGTTAGGGTTTGGGGTTTTTTTGTTTTTGTTTTTGTTTTTTAATTTCTTGATTTCAACATTTTCTCCCACCCTCTCGGCTGCAGCCAACGCCTCTTACCTGTTCTGCGGCGCCGCGCACCGCTGGCAGCTGAGGGTTAGAAAGCGGGGTGTATTTTAGATTTTAAGCAAAAATTTTAAAGATAAATCCATTTTTCTCTCCCACCCCCAACGCCATCTCCACTGCATCCGATCTCATTATTTCGGTGGTTGCTTGGGGGTGAACAATTTTGTGGCTTTTTTTCCCCTATAATTCTGACCCGCTCAGGCTTGAGGGTTTCTCCGGCCTCCGCTCACTGCGTGCACCTGGCGCTGCCCTGCTTCCCCCAACCTGTTGCAAGGCTTTAATTCTTGCAACTGGGACCTG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Dong Hyup Lee et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 17(2), 157-162 (2013-04-30)
Insulin-like growth factor binding proteins (IGFBPs) are important components of insulin growth factor (IGF) signaling pathways. One of the binding proteins, IGFBP-5, enhances the actions of IGF-1, which include the enhanced proliferation of smooth muscle cells. In the present study
Wenyu Wang et al.
Molecular cancer therapeutics, 17(9), 1973-1983 (2018-06-22)
Despite showing promise against PIK3CA-mutant breast cancers in preclinical studies, PI3K/AKT pathway inhibitors demonstrate limited clinical efficacy as monotherapy. Here, we found that histone H3K27me3 demethylase KDM6B-targeted IGFBP5 expression provides a protective mechanism for PI3K/AKT inhibitor-induced apoptosis in breast cancer
Bong-Ki Hong et al.
Experimental & molecular medicine, 49(8), e363-e363 (2017-08-05)
Fibroblast-like synoviocytes (FLSs) constitute a major cell subset of rheumatoid arthritis (RA) synovia. Dysregulation of microRNAs (miRNAs) has been implicated in activation and proliferation of RA-FLSs. However, the functional association of various miRNAs with their targets that are characteristic of
Younghay Lee et al.
Cells, 8(4) (2019-04-26)
Type 2 diabetes mellitus (T2DM) is a prevalent chronic metabolic disorder accompanied by high blood glucose, insulin resistance, and relative insulin deficiency. Endoplasmic reticulum (ER) stress induced by high glucose and free fatty acids has been suggested as one of
Junyun Wang et al.
Oncotarget, 6(24), 20636-20649 (2015-05-27)
The insulin-like growth factor binding protein 5 (IGFBP5), which is often dysregulated in human cancers, plays a crucial role in carcinogenesis and cancer development. However, the function and underlying mechanism of IGFBP5 in tumor growth and metastasis has been elusive

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej