Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU143271

Sigma-Aldrich

MISSION® esiRNA

targeting human ILK

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000166333

numer dostępu NCBI

NM_001014794

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ILK(3611) , ILK(3611)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
JUU
KNU
ZDS
DOR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Patricia Sosa et al.
Aging and disease, 9(5), 769-784 (2018-10-03)
In mammalians, advancing age is associated with sarcopenia, the progressive and involuntary loss of muscle mass and strength. Hyperphosphatemia is an aging-related condition involved in several pathologies. The aim of this work was to assess whether hyperphosphatemia plays a role
Xiu-Mei Yang et al.
Investigative ophthalmology & visual science, 59(5), 1779-1789 (2018-04-04)
Vasculogenesis has been shown to contribute to the formation of choroidal neovascularization (CNV). However, the mechanism behind the recruitment of endothelial progenitor cells (EPC) to CNV is not well understood. Therefore, we were interested to know whether integrin-linked kinase (ILK)
Maria Louca et al.
Molecular and cellular biochemistry, 471(1-2), 143-153 (2020-06-09)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor and it is associated with poor survival. Integrin-linked kinase (ILK) is a serine/threonine protein pseudo-kinase that binds to the cytoplasmic domains of β1 and β3 integrins and has been
Zhen-Hua Liu et al.
Nutrition and cancer, 72(6), 968-975 (2019-10-02)
The change of fatty acid composition has been regarded as an indicator of altered lipid metabolism during human tumourigenesis, but the details are still unclear. We have previously demonstrated a monounsaturated fatty acid (MUFA) named oleic acid (OA) was involved
A Shvab et al.
Oncogene, 35(5), 549-557 (2015-04-29)
Overactivation of Wnt-β-catenin signaling, including β-catenin-TCF target gene expression, is a hallmark of colorectal cancer (CRC) development. We identified the immunoglobulin family of cell-adhesion receptors member L1 as a β-catenin-TCF target gene preferentially expressed at the invasive edge of human
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej