Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU138301

Sigma-Aldrich

MISSION® esiRNA

targeting human MGRN1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACCATCTACTGCCAGGCATCGGAGGAGTTCCTGAACGGCAGGGCAGTATACAGCCCCAAGAGCCCCTCGCTACAGTCCGAGACCGTCCACTACAAGAGAGGGGTGAGCCAGCAGTTCTCCCTGCCCTCCTTCAAGATTGACTTCTCGGAATGGAAGGATGACGAGCTGAACTTTGACCTGGACCGGGGCGTGTTTCCAGTAGTCATCCAGGCTGTGGTGGACGAAGGAGATGTGGTGGAAGTGACTGGCCACGCCCACGTGCTCTTGGCTGCCTTTGAAAAGCACATGGACGGCAGCTTCTCTGTGAAGCCTTTAAAGCAGAAGCAAATTGTGGACCGGGTCAGCTACCTCCTGCAGGAGATCTATGGCATTGAGAACAAGAACAACCAGGAGACCAAGCCCTCGGACGACGAGAACAGCGACAACAGCAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000102858

numer dostępu NCBI

NM_001142289

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MGRN1(23295) , MGRN1(23295)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
XZU
OWU
QCS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Karen Legler et al.
British journal of cancer, 118(6), 847-856 (2018-01-31)
Alterations in protein glycosylation have been related to malignant transformation and tumour progression. We recently showed that low mRNA levels of Golgi alpha-mannosidase MAN1A1 correlate with poor prognosis in breast cancer patients. We analysed the role of MAN1A1 on a
Min Deng et al.
Molecular medicine reports, 20(1), 368-374 (2019-05-23)
The activation of hepatic stellate cells (HSCs) is considered associated with liver fibrosis. However, the exact role of syndecan‑1 (SDC1), a protein that regulates the interaction between cells and the microenvironment, in the activation of HSCs resulting in liver fibrosis
Hao Gao et al.
Cell cycle (Georgetown, Tex.), 18(12), 1393-1406 (2019-05-28)
Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy, and its vulnerability to metastasis contributes to the poor outcomes of EOC patients. Long noncoding RNAs (lncRNAs) were verified to play a pivotal role in EOC metastasis. However, the potential
Deepak Chhangani et al.
Biochimica et biophysica acta, 1842(9), 1472-1484 (2014-04-29)
Polyglutamine diseases are a family of inherited neurodegenerative diseases caused by the expansion of CAG repeats within the coding region of target genes. Still the mechanism(s) by which polyglutamine proteins are ubiquitinated and degraded remains obscure. Here, for the first
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej