Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU130641

Sigma-Aldrich

MISSION® esiRNA

targeting human SORT1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTCCTGGGTTGGAGATAGCACTGGGGTCATTCTAGTCTTGACTACCTTCCATGTACCACTGGTAATTATGACTTTTGGACAGTCCAAGCTATATCGAAGTGAGGATTATGGGAAGAACTTTAAGGATATTACAGATCTCATCAATAACACCTTTATTCGGACTGAATTTGGCATGGCTATTGGTCCTGAGAACTCTGGAAAGGTGGTGTTAACAGCAGAGGTGTCTGGAGGAAGTCGTGGAGGAAGAATCTTTAGATCATCAGATTTTGCGAAGAATTTTGTGCAAACAGATCTCCCTTTTCATCCTCTCACTCAGATGATGTATAGCCCTCAGAATTCTGATTATCTTTTAGCTCTCAGCACTGAAAATGGCCTGTGGGTGTCCAAGAATTTTGGGGGAAAATGGGAAGAAATCCACAAAGCAGTATGTTTGGCCAAATGGGGATCAGACAACACCATCTTCTTTACAACCTATGCAAATGGCTCCTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000134243

numer dostępu NCBI

NM_002959

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SORT1(6272) , SORT1(6272)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
CDV
IMS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yuncheng Lv et al.
Acta biochimica et biophysica Sinica, 51(5), 471-483 (2019-04-06)
Sortilin is closely associated with hyperlipidemia and the risk of atherosclerosis (AS). The role of sortilin and the underlying mechanism in peripheral macrophage are not fully understood. In this study, we investigated the effect of macrophage sortilin on ATP-binding cassette
Hye Youn Sung et al.
Journal of stroke, 20(3), 350-361 (2018-10-13)
The pathogenesis of moyamoya disease (MMD) remains poorly understood, and no reliable molecular biomarkers for MMD have been identified to date. The present study aimed to identify epigenetic biomarkers for use in the diagnosis of MMD. We performed integrated analyses
Keiji Uchiyama et al.
PLoS pathogens, 13(6), e1006470-e1006470 (2017-07-01)
Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains
Swati Venkat et al.
Molecular biology of the cell, 28(19), 2569-2578 (2017-08-05)
Elevated, nontoxic doses of manganese (Mn) protect against Shiga toxin-1-induced cell death via down-regulation of GPP130, a cycling Golgi membrane protein that serves as an endosome-to-Golgi trafficking receptor for the toxin. Mn binds to GPP130 in the Golgi and causes
Fangfang Gao et al.
The American journal of pathology, 190(9), 1931-1942 (2020-06-12)
Pancreatic cancer has a dismal prognosis, and there is no targeted therapy against this malignancy. The neuronal membrane protein sortilin is emerging as a regulator of cancer cell development, but its expression and impact in pancreatic cancer are unknown. This
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej