Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU130241

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXP3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAAATGGTGTCTGCAAGTGGCCCGGATGTGAGAAGGTCTTCGAAGAGCCAGAGGACTTCCTCAAGCACTGCCAGGCGGACCATCTTCTGGATGAGAAGGGCAGGGCACAATGTCTCCTCCAGAGAGAGATGGTACAGTCTCTGGAGCAGCAGCTGGTGCTGGAGAAGGAGAAGCTGAGTGCCATGCAGGCCCACCTGGCTGGGAAAATGGCACTGACCAAGGCTTCATCTGTGGCATCATCCGACAAGGGCTCCTGCTGCATCGTAGCTGCTGGCAGCCAAGGCCCTGTCGTCCCAGCCTGGTCTGGCCCCCGGGAGGCCCCTGACAGCCTGTTTGCTGTCCGGAGGCACCTGTGGGGTAGCCATGGAAACAGCACATTCCCAGAGTTCCTCCACAACATGGACTACTTCAAGTTCCACAACATGCGACCCCCTTTCACCTACGCCACGCTCATCCGCTGGGCCATCCTGGAGGCTCCAGAGAAGCAGCGGACACTCAAT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hanwei Zhang et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(21), 5349-5361 (2016-11-03)
The transcriptional regulation mediating cancer cell differentiation into distinct molecular subtypes and modulating sensitivity to existing treatments is an enticing therapeutic target. Our objective was to characterize the ability of the forkhead/winged transcription factor FOXP3 to modulate the differentiation of
Grethe Skretting et al.
Journal of cellular biochemistry, 120(8), 12924-12936 (2019-03-13)
Single nucleotide polymorphisms (SNPs) may play an important role in the risk of certain diseases. We have previously shown that the -287T/C SNP of the tissue factor pathway inhibitor (TFPI) gene promoter region exerts differential impact on TFPI mRNA expression;
Dong Fan et al.
Oncology letters, 20(6), 292-292 (2020-10-27)
Forkhead box P3 (FOXP3), an X-linked tumor suppressor gene, plays an important role in breast cancer. However, the biological functions of FOXP3 in breast cancer apoptosis remain unclear. To investigate the underlying genes and networks regulated by FOXP3 in breast
Chun Li et al.
Pathology, research and practice, 213(10), 1251-1256 (2017-09-25)
Our study aimed to investigate the biological role of FOXP3 expression in human lung adenocarcinoma (LAD) tissues and evaluate its involvement in cell proliferation and chemosensitivity to cisplatin in LAD cells. Paraffin-embedded tissues from 50 LAD patients were collected to
Maria Napolitano et al.
Oncotarget, 6(10), 8261-8270 (2015-04-01)
Short-course preoperative radiotherapy (SC-RT) followed by total mesorectal excision (TME) is one therapeutic option for locally advanced rectal cancer (LARC) patients. Since radio-induced DNA damage may affect tumor immunogenicity, Myeloid-derived suppressor cells (MDSCs) and T regulatory cells (Tregs) were evaluated

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej