Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU122711

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGEF12

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGTGCAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTTACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCTGTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTTTCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGAAAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCAAGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTATGGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000196914

numer dostępu NCBI

NM_015313

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ARHGEF12(23365) , ARHGEF12(23365)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Anil Prasad et al.
Scientific reports, 7, 40648-40648 (2017-01-18)
DC-SIGN is a dendritic cell surface structure which participates in binding and transmission of HIV-1. Here, for the first time we demonstrate that cocaine induces over expression of DC-SIGN and significantly enhances virus transfer from DCs to T-cells by increasing
Wei-Chiao Chiu et al.
International journal of nanomedicine, 7, 5929-5939 (2012-12-13)
Studies to explore angiotensin II (Ang II) and its downstream signaling pathways via Rho guanine nucleotide exchange factors (RhoGEFs) and RhoA signaling are crucial to understanding the mechanisms of smooth muscle contraction leading to hypertension. This study aimed to investigate
Katsuhiko Hata et al.
The Journal of cell biology, 184(5), 737-750 (2009-03-11)
Neuronal axons are guided by attractive and repulsive cues in their local environment. Because the repulsive guidance molecule A (RGMa) was originally identified as an axon repellent in the visual system, diverse functions in the developing and adult central nervous
Jing Cai et al.
Genes & development, 32(11-12), 781-793 (2018-06-13)
Autosomal dominant polycystic kidney disease (ADPKD) is an inherited disorder caused by mutations in PKD1 or PKD2 and affects one in 500-1000 humans. Limited treatment is currently available for ADPKD. Here we identify the Hippo signaling effector YAP and its

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej