Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU122491

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTTTCTCCGGCAAGTACCAACTGCAGAGCCAGGAAAACTTTGAAGCCTTCATGAAGGCAATCGGTCTGCCGGAAGAGCTCATCCAGAAGGGGAAGGATATCAAGGGGGTGTCGGAAATCGTGCAGAATGGGAAGCACTTCAAGTTCACCATCACCGCTGGGTCCAAAGTGATCCAAAACGAATTCACGGTGGGGGAGGAATGTGAGCTGGAGACAATGACAGGGGAGAAAGTCAAGACAGTGGTTCAGTTGGAAGGTGACAATAAACTGGTGACAACTTTCAAAAACATCAAGTCTGTGACCGAACTCAACGGCGACATAATCACCAATACCATGACATTGGGTGACATT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000163586

numer dostępu NCBI

NM_001443

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FABP1(2168) , FABP1(2168)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yujuan Wang et al.
PloS one, 14(4), e0214144-e0214144 (2019-04-23)
Castration is an important means of improving the beef quality via increasing fat deposition. However, little is known about the molecular mechanism underlying the fat deposition after castration. Here, the intramuscular fat (IMF) content of the steer group was shown
Yufei Chen et al.
Journal of pharmacy & pharmaceutical sciences : a publication of the Canadian Society for Pharmaceutical Sciences, Societe canadienne des sciences pharmaceutiques, 20(0), 239-251 (2017-08-16)
To investigate the effect of clofibrate on inducing liver fatty acid binding protein (FABP1) following a high-fat load in a hepatocyte cell culture model. Rat hepatoma cells (CRL-1548) were treated with a fatty acid (FA) mixture consisting of oleate:palmitate (2:1)
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej