Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU119431

Sigma-Aldrich

MISSION® esiRNA

targeting human PDPN

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGCTCTTCGTTTTGGGAAGCGCGTCGCTCTGGGTCCTGGCAGAAGGAGCCAGCACAGGCCAGCCAGAAGATGACACTGAGACTACAGGTTTGGAAGGCGGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCTGGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATCTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTCAAACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAGAAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATCGGCTTCATTGGTGCAATCATCGT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000162493

numer dostępu NCBI

NM_006474

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PDPN(10630) , PDPN(10630)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
QCS
CIT
LCS
RWR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jiang-Chao Li et al.
Molecular medicine reports, 10(3), 1513-1518 (2014-06-19)
Podoplanin (PDPN) is a well established lymphatic endothelial marker and has frequently been observed in cancer cells at the edge of cancer masses. Previous studies investigating the association between PDPN expression and patient prognosis have had contradictory results. In the
Ekele Ikpegbu et al.
Journal of cellular physiology, 233(7), 5334-5347 (2017-12-08)
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the
Lewis S C Ward et al.
Journal of cell science, 132(5) (2019-02-13)
Mesenchymal stromal cells (MSCs) upregulate podoplanin at sites of infection, chronic inflammation and cancer. Here, we investigated the functional consequences of podoplanin expression on the migratory potential of MSCs and their interactions with circulating platelets. Expression of podoplanin significantly enhanced
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined
Yan Song et al.
Cellular and molecular neurobiology, 34(6), 839-849 (2014-05-14)
Podoplanin (PDPN) is a mucin-type transmembrane sialoglycoprotein expressed in multiple tissues in adult animals, including the brain, lungs, kidney, and lymphoid organs. Studies of this molecule have demonstrated its great importance in tumor metastasis, platelet aggregation, and lymphatic vessel formation.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej