Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU118761

Sigma-Aldrich

MISSION® esiRNA

targeting human ITPR3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCCTGTGACACTCTGTTGATGTGCATCGTCACTGTCATGAACCATGGGCTACGCAACGGTGGTGGCGTGGGCGACATTCTCCGCAAGCCCTCCAAAGATGAGTCTCTCTTCCCAGCCCGAGTGGTCTATGACCTCCTGTTCTTCTTCATCGTCATCATCATTGTGCTGAACCTCATCTTTGGGGTAATCATCGACACCTTCGCTGACCTGCGTAGTGAGAAGCAGAAGAAGGAGGAGATTCTTAAGACGACATGCTTCATCTGTGGTCTGGAGAGGGACAAGTTTGATAACAAGACAGTGTCATTTGAGGAACACATCAAGCTGGAGCACAACATGTGGAACTACTTGTACTTCATTGTGCTGGTCCGCGTGAAGAACAAGACCGACTACACGGGCCCTGAGAGCTACGTGGCCCAGATGATCAAGAACAAGAACCTGGACTGGTTCCCCCGGATGCGGGCCATGTCCCTTGTCAGCAATGAGGGCGAGGGGGAGCAGAATGAGATTCGGATTCTCCAGGACAAGCTCAACTCCACCATGA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Są one heterogeniczną mieszaniną siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także zapoznać się ze wszystkimi dostępnymi opcjami esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Francesca Iommelli et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(13), 3126-3136 (2018-04-06)
Purpose: Our aim was to test whether imaging with 18F-fluorothymidine (18F-FLT) PET/CT was able to detect the combined effects of EGFR and MET inhibitors in oncogene-driven non-small cell lung cancer (NSCLC) and to elucidate the mechanisms underlying the enhanced efficacy
Abdallah Mound et al.
Oncotarget, 8(42), 72324-72341 (2017-10-27)
Breast cancer remains a research priority due to its invasive phenotype. Although the role of ion channels in cancer is now well established, the role of inositol (1,4,5)-trisphosphate (IP
Ming He et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(5), 902-914 (2019-03-29)
Objective- The topographical distribution of atherosclerosis in vasculature underscores the importance of shear stress in regulating endothelium. With a systems approach integrating sequencing data, the current study aims to explore the link between shear stress-regulated master transcription factor and its
Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Zheng Zeng et al.
Journal of pharmacological sciences, 126(1), 37-46 (2014-09-23)
This study determined the regulatory effect of inositol 1,4,5-trisphosphate receptors (IP3Rs) on the basal Ca(2+) transients in cardiomyocytes. In cultured neonatal rat ventricular myocytes (NRVMs) at different densities, we used confocal microscopy to assess the effect of IP3Rs on the

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej