Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU115801

Sigma-Aldrich

MISSION® esiRNA

targeting human GSTM1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTGAAGGCCAGGAGGTGGGAGTGAGGAGCCCATACTCAGCCTGCTGCCCAGGCTGTGCAGCGCAGCTGGACTCTGCATCCCAGCACCTGCCTCCTCGTTCCTTTCTCCTGTTTATTCCCATCTTTACTCCCAAGACTTCATTGTCCCTCTTCACTCCCCCTAAACCCCTGTCCCATGCAGGCCCTTTGAAGCCTCAGCTACCCACTATCCTTCGTGAACATCCCCTCCCATCATTACCCTTCCCTGCACTAAAGCCAGCCTGACCTTCCTTCCTGTTAGTGGTTGTGTCTGCTTTAAAGGGCCTGCCTGGCCCCTCGCCTGTGGAGCTCAGCCCCGAGCTGTCCCCGTGTTGCATGAAGGAGCAGCATTGACTGGT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000134184

numer dostępu NCBI

NM_146421

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... GSTM1(2944) , GSTM1(2944)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Pritha Bhattacharjee et al.
Scientific reports, 3, 2704-2704 (2013-09-21)
The gene for glutathione-S-transferase (GST) M1 (GSTM1), a member of the GST-superfamily, is widely studied in cancer risk with regard to the homozygous deletion of the gene (GSTM1 null), leading to a lack of corresponding enzymatic activity. Many of these
Yi Lu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 120, 109532-109532 (2019-10-13)
Reactive oxygen species (ROS) are implicated in carcinogenesis, and cellular antioxidant systems are important for detoxifying ROS and reversing oxidant-mediated modifications. Glutathione S-transferase mu (GSTM) belongs to a family of phase II detoxification enzymes that catalyze the conjugation of reduced
Weidong Wu et al.
Particle and fibre toxicology, 9, 31-31 (2012-08-08)
Diesel exhaust particles (DEP) contribute substantially to ambient particulate matter (PM) air pollution in urban areas. Inhalation of PM has been associated with increased incidence of lung disease in susceptible populations. We have demonstrated that the glutathione S-transferase M1 (GSTM1)

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej