Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU114701

Sigma-Aldrich

MISSION® esiRNA

targeting human CD46

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGTCTCAGATGACGCCTGTTATAGAGAAACATGTCCATATATACGGGATCCTTTAAATGGCCAAGCAGTCCCTGCAAATGGGACTTACGAGTTTGGTTATCAGATGCACTTTATTTGTAATGAGGGTTATTACTTAATTGGTGAAGAAATTCTATATTGTGAACTTAAAGGATCAGTAGCAATTTGGAGCGGTAAGCCCCCAATATGTGAAAAGGTTTTGTGTACACCACCTCCAAAAATAAAAAATGGAAAACACACCTTTAGTGAAGTAGAAGTATTTGAGTATCTTGATGCAGTAACTTATAGTTGTGATCCTGCACCTGGACCAGATCCATTTTCACTTATTGGAGAGAGCACGATTTATTGTGGTGACAATTCAGTGTGGAGTCGTGCTGCTCCAGAGTGTA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000117335

numer dostępu NCBI

NM_172352

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CD46(4179) , CD46(4179)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Kathryn R Stein et al.
Nature communications, 10(1), 2699-2699 (2019-06-22)
Human cytomegalovirus (CMV) causes a wide array of disease to diverse populations of immune-compromised individuals. Thus, a more comprehensive understanding of how CMV enters numerous host cell types is necessary to further delineate the complex nature of CMV pathogenesis and
Meng-Lay Lin et al.
Oncotarget, 6(25), 21685-21703 (2015-08-19)
The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other
Pei Qiao et al.
Scientific reports, 7(1), 145-145 (2017-03-10)
Bullous pemphigoid (BP) is an autoimmune bullous disease caused by autoantibodies against BP180 in the epidermal basement membrane. Autoantibody-mediated complement activation is an important process in BP pathogenesis. CD46, a crucial complement regulatory protein in the complement activation, has been
J Song et al.
Cell death & disease, 6, e1844-e1844 (2015-08-08)
In the central nervous system (CNS), hyperglycemia leads to neuronal damage and cognitive decline. Recent research has focused on revealing alterations in the brain in hyperglycemia and finding therapeutic solutions for alleviating the hyperglycemia-induced cognitive dysfunction. Adiponectin is a protein

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej