Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU113961

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK7

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACTGAAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAAGACTAGAGCAGCGAACTGCGACGATCACTTAGAGAAACAGGCCGTTAGGAATCCATTCTCACTGTGTTCGCTCTAAACAAAACAGTGGTAGGTTAATGTGTTCAGAAGTCGCTGTCCTT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000116288

numer dostępu NCBI

NM_007262

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PARK7(11315) , PARK7(11315)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hua-Zong Zeng et al.
International journal of molecular sciences, 12(6), 3489-3499 (2011-07-13)
The aim of study is to identify cisplatin-resistance associated biomarkers for non-small cell lung cancers (NSCLC). We use two-dimensional electrophoresis (2-DE) combined with MALDI-TOF mass spectrometry to compare the proteome between lung cancer cell line A549 and its cisplatin-resistant subline
Bijun Qiu et al.
Oncotarget, 8(5), 8499-8511 (2016-12-31)
Chronic liver inflammation and injuries play a critical role in development of hepatocellular carcinoma (HCC). Parkinson disease (autosomal recessive, early onset) 7, encoding PARK7 protein (also called DJ-1), plays important roles in many carcinogenesis processes and is essential in modulating
Canan Schumann et al.
Molecular pharmaceutics, 13(6), 2070-2083 (2016-05-14)
We report an efficient therapeutic modality for platinum resistant ovarian cancer based on siRNA-mediated suppression of a multifunctional DJ-1 protein that is responsible for the proliferation, growth, invasion, oxidative stress, and overall survival of various cancers. The developed therapeutic strategy
Prahlad V Raninga et al.
Apoptosis : an international journal on programmed cell death, 21(12), 1422-1437 (2016-10-28)
Multiple myeloma (MM) is an incurable plasma B cell malignancy. Despite recent advancements in anti-MM therapies, development of drug resistance remains a major clinical hurdle. DJ-1, a Parkinson's disease-associated protein, is upregulated in many cancers and its knockdown suppresses tumor
Xiao-Ling Zhang et al.
Toxicology letters, 271, 74-83 (2017-03-02)
Oxidative stress is thought to be involved in the development of Parkinson's disease (PD). We previously reported that 20C, a bibenzyl compound isolated from Gastrodia elata, possesses antioxidative properties, but its in-depth molecular mechanisms against rotenone-induced neurotoxicity remains unknown. Recent
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej