Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU113611

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXO3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TATGCAAACCCTCTCGGACTCTCTCTCAGGCTCCTCCTTGTACTCAACTAGTGCAAACCTGCCCGTCATGGGCCATGAGAAGTTCCCCAGCGACTTGGACCTGGACATGTTCAATGGGAGCTTGGAATGTGACATGGAGTCCATTATCCGTAGTGAACTCATGGATGCTGATGGGTTGGATTTTAACTTTGATTCCCTCATCTCCACACAGAATGTTGTTGGTTTGAACGTGGGGAACTTCACTGGTGCTAAGCAGGCCTCATCTCAGAGCTGGGTGCCAGGCTGAAGGATCACTGAGGAAGGGGAAGTGGGCAAAGCAGACCCTCAAACTGACACAAGACCTACAGAGAAAACCCTTTGCCAAATCTGCTCTCAGCAAGTGGACAGTGATACCGTTTACAGCTTAACACCTTTGTGAATCCCACGCCATTTTCCTAACCCAGCAGAGACTGTTAATGGCCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000118689

numer dostępu NCBI

NM_001455

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FOXO3(2309) , FOXO3(2309)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ning Liu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 66(7), 603-610 (2017-04-13)
Fibroblast-like synoviocytes (FLS) play an essential role in the pathogenesis of chronic inflammatory diseases, such as rheumatoid arthritis. Paeonol (Pae) is a phenolic compound found in many traditional Chinese medicine remedies. However, the effects of Pae on TNF-α-stimulated FLS and
M Kumazoe et al.
Oncogene, 36(19), 2643-2654 (2016-11-29)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most fatal types of cancer and the 5-year survival rate is only 5%. Several studies have suggested that cancer stem cells (CSCs) are thought to be involved in recurrence and metastasis and
Yanqiu Wang et al.
Biochemical and biophysical research communications, 524(3), 756-763 (2020-02-10)
Intervertebral disc degeneration (IDD) is typically accompanied by a reduced nutrient supply, which is thought to be a contributor to the apoptosis of nucleus pulposus cells (NPCs). Here, we explored whether Forkhead box O3 (FOXO3), a key transcription factor involved
Jangsoon Lee et al.
Breast cancer research and treatment, 146(2), 259-272 (2014-06-12)
Although there are effective HER2-targeted agents, novel combination strategies in HER2-overexpressing breast cancers are needed for patients whose tumors develop drug resistance. To develop new therapeutic strategy, we investigated the combinational effect of entinostat, an oral isoform-selective histone deacetylase type
Fei Wang et al.
Folia histochemica et cytobiologica, 58(1), 1-8 (2020-02-01)
Osteoarthritis (OA) is the most common degenerative disease in middle-aged and elderly individuals that causes joint deformity and limb disability. Accumulating evidence has suggested that the pathogenesis of OA has been related to various mechanisms such as apoptosis, inflammation, oxidative
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej