Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU113511

Sigma-Aldrich

MISSION® esiRNA

targeting human BAK1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAACCGACGCTATGACTCAGAGTTCCAGACCATGTTGCAGCACCTGCAGCCCACGGCAGAGAATGCCTATGAGTACTTCACCAAGATTGCCACCAGCCTGTTTGAGAGTGGCATCAATTGGGGCCGTGTGGTGGCTCTTCTGGGCTTCGGCTACCGTCTGGCCCTACACGTCTACCAGCATGGCCTGACTGGCTTCCTAGGCCAGGTGACCCGCTTCGTGGTCGACTTCATGCTGCATCACTGCATTGCCCGGTGGATTGCACAGAGGGGTGGCTGGGTGGCAGCCCTGAACTTGGGCAATGGTCCCATCCTGAACGTGCTGGTGGTTCTGGGTGTGGTTCTGTTGGGCCAGTTTGTGGTACGAAGATTCTTCAAATCATGACTCCCAAGGGTGCCCTTTGGGGTCCCGGTTCAGACCCCTGCCTGGACTTAAGCGAAGTCTTTGCCTTCTCTGTTCCCTTGCAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Shunnan Yao et al.
Cancer letters, 483, 87-97 (2020-04-09)
Hepatocellular carcinoma (HCC) is a common malignancy with a poor prognosis. Dimethylaminomicheliolide (DMAMCL) is a novel antitumor agent that has been tested in phase I clinical trials; however, little is known regarding its effects in HCC. In this study, we
Chiaki Tsuge Ishida et al.
Oncotarget, 8(23), 37140-37153 (2017-04-19)
Malignant gliomas display high levels of the transcription factor c-myc and organize a tumor specific chaperone network within mitochondria. Here, we show that c-myc along with mitochondrial chaperone inhibition displays massive tumor cell death. Inhibition of mitochondrial matrix chaperones and
Haiyan Tan et al.
Oncotarget, 6(36), 39184-39195 (2015-10-10)
Prostate cancer is the second most commonly diagnosed cancer among men in the United States. Prostate cancer therapy is severely hampered by lack of response and development of resistance to conventional chemotherapeutic drugs in patients. Therefore, the development and discovery
Rong Zhang et al.
Cell death & disease, 9(6), 598-598 (2018-05-24)
Hirsutine extracted from Uncaria rhynchophylla has been shown to exhibit anti-cancer activity. However, the molecular mechanism by which hirsutine exhibits anti-lung cancer activity remains unclear. In the present study, we showed that hirsutine induces apoptosis in human lung cancer cells
Melissa Desouza-Armstrong et al.
Cytoskeleton (Hoboken, N.J.), 74(6), 233-248 (2017-04-06)
The actin cytoskeleton is a polymer system that acts both as a sensor and mediator of apoptosis. Tropomyosins (Tpm) are a family of actin binding proteins that form co-polymers with actin and diversify actin filament function. Previous studies have shown

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej