Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU110021

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC25A5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGCTGGAGCTGAAAGGGAATTCCGAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAAGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTATTATCATCTACCGAGCCGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCGGATCCCAAGAACACTCACATCGTCATCAGCTGGATGATCGCACAGACTGTCACTGCTGTTGCCGGGTTGACTTCCTATCCATTTGACACTGTTCGCCGCCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGACATCATGTACACAGGCACGCTTGACTGCTGGCGGAAGATTGCTCGTGATGAAGGAGGCAAAGCTTTTTTCAAGGGTGCATGGTCCAATGTTCTCAGAGGCATGGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000005022

numer dostępu NCBI

NM_001152

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SLC25A5(292) , SLC25A5(292)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ji-Young Jang et al.
Experimental & molecular medicine, 45, e3-e3 (2013-01-12)
MicroRNAs (miRNAs) participate in diverse biological functions and carcinogenesis by inhibiting specific gene expression. We previously reported that suppression of adenine nucleotide translocase 2 (ANT2) by using the short hairpin RNA (shRNA) approach has an antitumor effect in several cancer
Yun Choi et al.
BMC cancer, 13, 143-143 (2013-03-26)
It is important to simultaneously induce strong cell death and antitumor immunity in cancer patients for successful cancer treatment. Here, we investigated the cytotoxic and phenotypic modulation effects of the combination of ANT2 shRNA and human sodium iodide symporter (hNIS)
Linh Ho et al.
Aging, 5(11), 835-849 (2013-12-04)
Efficient coupling of cellular energy production to metabolic demand is crucial to maintain organismal homeostasis. Here, we report that the mitochondrial Sirtuin Sirt4 regulates mitochondrial ATP homeostasis. We find that Sirt4 affects mitochondrial uncoupling via the adenine nucleotide translocator 2
Ji-Young Jang et al.
Breast cancer research : BCR, 10(1), R11-R11 (2008-02-13)
Adenine nucleotide translocator (ANT) 2 is highly expressed in proliferative cells, and ANT2 induction in cancer cells is known to be directly associated with glycolytic metabolisms and carcinogenesis. In addition, ANT2 repression results in the growth arrest of human cells
Ji-Young Jang et al.
Molecular cancer, 9, 262-262 (2010-09-30)
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL; apo2 ligand) induces apoptosis in cancer cells but has little effect on normal cells. However, many cancer cell types are resistant to TRAIL-induced apoptosis, limiting the clinical utility of TRAIL as an anti-cancer
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej