Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU109591

Sigma-Aldrich

MISSION® esiRNA

targeting human PHB

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCTGAGCAACAGAAAAAGGCGGCCATCATCTCTGCTGAGGGCGACTCCAAGGCAGCTGAGCTGATTGCCAACTCACTGGCCACTGCAGGGGATGGCCTGATCGAGCTGCGCAAGCTGGAAGCTGCAGAGGACATCGCGTACCAGCTCTCACGCTCTCGGAACATCACCTACCTGCCAGCGGGGCAGTCCGTGCTCCTCCAGCTGCCCCAGTGAGGGCCCACCCTGCCTGCACCTCCGCGGGCTGACTGGGCCACAGCCCCGATGATTCTTAACACAGCCTTCCTTCTGCTCCCACCCCAGAAATCACTGTGAAATTTCATGATTGGCTTAAAGTGAAGGAAATAAAGGTAAAATCACTTCAGATCTCTAATTAGTCTATCAAATGAAACTCTTTCATTCTTCTCACATCCATCTACTTTTTTATCCACCTCCCTACCAAAAATTGCCAAGTGCCTATGCAAACCAGCT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000167085

numer dostępu NCBI

NM_002634

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PHB(5245) , PHB(5245)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Lijun Sun et al.
Biochemical and biophysical research communications, 513(2), 446-451 (2019-04-11)
Influenza virus infection is associated with type 1 diabetes (T1DM), but its pathogenesis remains unclear. Here, our study found that one of the monoclonal antibodies against H1N1 influenza virus hemagglutinin(HA) cross-reacted with human pancreatic tissue and further demonstrated that it
Debabrata Chowdhury et al.
Molecular and cellular biochemistry, 425(1-2), 155-168 (2016-11-18)
Numerous hypertrophic stimuli, including β-adrenergic agonists such as isoproterenol (ISO), result in generation of reactive oxygen species (ROS) and alteration in the mitochondrial membrane potential (Δψ) leading to oxidative stress. This process is well associated with phosphorylation of thymoma viral
Kinnosuke Yahiro et al.
Cellular microbiology, 21(8), e13033-e13033 (2019-04-23)
Vibrio cholerae produced-Cholix toxin (Cholix) is a cytotoxin that ADP-ribosylates eukaryotic elongation factor 2, inhibiting protein synthesis, and inducing apoptosis. Here, we identified prohibitin (PHB) 1 and 2 as novel Cholix-interacting membrane proteins in immortalised human hepatocytes and HepG2 cells
Hajime Yurugi et al.
Journal of cell science, 133(12) (2020-06-06)
The RAS oncogenes are frequently mutated in human cancers and among the three isoforms (KRAS, HRAS and NRAS), KRAS is the most frequently mutated oncogene. Here, we demonstrate that a subset of flavaglines, a class of natural anti-tumour drugs and
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej