Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU108041

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT7

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGAGTGTGGACACTGCTTCAGAAAGGGAGAAGCGTTAGTGCTGCCGACCTGAGCGAGGCCGAGCCACTCACCCACATGAGCATCACCCGTCTGCATGAGCAGAAGCTGGTGCAGCATGTGGTGTCTCAGAACTGTGACGGGCTCCACCTGAGGAGTGGGCTGCCGCGCACGGCCATCTCCGAGCTCCACGGGAACATGTACATTGAAGTCTGTACCTCCTGCGTTCCCAACAGGGAGTACGTGCGGGTGTTCGATGTGACGGAGCGCACTGCCCTCCACAGACACCAGACAGGCCGGACCTGCCACAAGTGTGGGACCCAGCTGCGGGACACCATTGTGCACTTTGGGGAGAGGGGGACGTTGGGGCAGCCTTTGAACTGGGAAGCGACCGAGGCTGCCAGCAGAGCAGACACCATCCT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Romain Haider et al.
Oncotarget, 8(44), 77309-77316 (2017-11-05)
Predictive biomarkers for advanced prostate cancer (PCa) are still missing. The sirtuin 7 (SIRT7) has been linked to tumorogenesis but its role in prostate cancer is poorly documented. To determine if SIRT7 can be a biomarker for aggressive prostate cancer
Bin Jia et al.
IUBMB life, 73(1), 264-272 (2020-12-17)
Oral squamous cell carcinoma (OSCC) is a common malignant cancer with unfavorable prognosis, and the epithelial-to-mesenchymal transition (EMT) is a critical contributor to OSCC metastasis. Recently, we have shown that sirtuin 7 (Sirt7) is associated with EMT and OSCC metastasis
Anne E Wyman et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L945-L958 (2017-04-08)
Pulmonary fibrosis is a severe condition with no cure and limited therapeutic options. A better understanding of its pathophysiology is needed. Recent studies have suggested that pulmonary fibrosis may be driven by accelerated aging-related mechanisms. Sirtuins (SIRTs), particularly SIRT1, SIRT3
Wang Wei et al.
American journal of cancer research, 7(9), 1788-1803 (2017-10-06)
It is still a controversy whether the role of Sirtuin 7 (SIRT7) is an oncogene or a tumor suppressor gene in cancer as SIRT7 may have different functions in different types of cancer. Particularly, the specific roles of SIRT7 in
Wenzhi Li et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 100, 257-266 (2018-02-14)
Accumulating evidence indicates that sirtuin7 (SIRT7) plays an oncogenic role in the main types of liver cancer, hepatocellular carcinoma (HCC). Nevertheless, the clinical significance of SIRT7 and its role in cholangiocarcinoma (CCA) is largely undiscovered. Here, we found that SIRT7

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej