Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU106761

Sigma-Aldrich

MISSION® esiRNA

targeting human STUB1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAATCTGCAGCGAGCTTACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGAATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAGCTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGCCAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATTGAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAGAAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATGCGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCACCTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTCATCCCCAACTTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000103266

numer dostępu NCBI

NM_005861

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... STUB1(10273) , STUB1(10273)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Qasim A Khan et al.
PloS one, 13(7), e0199699-e0199699 (2018-07-07)
ALDH1L1 is a folate-metabolizing enzyme abundant in liver and several other tissues. In human cancers and cell lines derived from malignant tumors, the ALDH1L1 gene is commonly silenced through the promoter methylation. It was suggested that ALDH1L1 limits proliferation capacity
Tao Xu et al.
American journal of cancer research, 7(2), 289-300 (2017-03-25)
Glioblastoma (GBM) is the most frequent, aggressive and fatal tumor in the central nervous system, while PTEN signaling is frequently deregulated in human GBM. We previously reported the up-regulation of the carboxyl terminal of Hsp70-interacting protein (CHIP) in GBM, however
Pengfei Zhang et al.
Cell death and differentiation, 27(11), 3177-3195 (2020-06-03)
Ovarian tumour domain-containing protein 3 (OTUD3), a key OTU (ovarian tumour protease) family deubiquitylase, plays context-dependent roles in cancers. It suppresses tumorigenesis in breast, colon, liver and cervical cancer through stabilizing PTEN (phosphatase and tension homologue deleted on chromosome 10)
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian
Jian Wang et al.
Oncotarget, 7(49), 81377-81388 (2016-11-12)
The androgen receptor (AR) is not only a ligand-dependent transcription factor, but also functions as a licensing factor, a component of DNA replication, which is degraded during mitosis. Furthermore, the deregulation of AR activity is involved in the initiation of
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej